AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i097_Phosphate_Transport_aful_reg_300.orf -o097_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG29809 87 Archaeoglobus_fulgidus Motif number 1 TATATCCAATAAATGGCTATATATC 1 1 0 AAGGTATATC 0.9995 -87 TAGAATATCGATAGGGATATATATCCAATAAATGG 1 20 0 AAGGTATATC 0.9995 -68 CCTTTTCCTTAAACGGTAGAATATCGATAGGGATA 1 36 0 AAGGAATATC 0.998356 -52 CCGTTTAAGGAAAAGGATATATATCAGAGTTCGAA 1 55 1 AAGGTATATC 0.999499 -33 GCAGAGCGTTCGAACTCTGATATATAT 1 71 0 AACGTAACTC 0.987297 -17 * * ** * ***** Masking position 11 Map Score: 13.5178 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 4 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TATATCCAATAAATGGCTATATATC 1 6 0 AAATGGCTAT 0.935841 -82 TAGAATATCGATAGGGATATATATCCAATA 1 25 0 ATAGGGATAT 0.771317 -63 CCGTTTAAGGAAAAGGATATATATCAGAGT 1 55 1 AAAAGGATAT 0.989863 -33 ********** Masking position 3 Map Score: 4.35519 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 24 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0