AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i099_Phosphate_Transport_1_aful_reg_300.orf -o099_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48533 126 Archaeoglobus_fulgidus Motif number 1 ATACCATCGTGAAAATCTAAATATTT 1 6 1 ATCTGAAAAT 0.963858 -121 TAGTTAGTAAATGTTGTATATACCATCCCTT 1 50 0 ATGTGTATAT 0.994413 -77 TACTAACTATATGATGTATATTTTAATGCGA 1 72 1 ATGTGTATAT 0.997771 -55 TTAATGCGACAAGATGTATATCTCTCAGATA 1 94 1 AAGTGTATAT 0.995025 -33 *** ******* Masking position 5 Map Score: 6.59302 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 22 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 AAAATCTAAATATTTATGCGTTTTCCCTAA 1 22 1 TATTTATGCG 0.995109 -105 ATGATGTATATTTTAATGCGACAAGATGTA 1 82 1 TTTTAATGCG 0.995118 -45 ********** Masking position 6 Map Score: 0.585025 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 8 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 AGTAAATGTTGTATATACCATCCCTTAGGG 1 46 0 GTATATACCA 0.988624 -81 ACTATATGATGTATATTTTAATGCGACAAG 1 77 1 GTATATTTTA 0.975119 -50 GCGACAAGATGTATATCTCTCAGATAATAC 1 99 1 GTATATCTCT 0.988624 -28 ********** Masking position 5 Map Score: 0.575827 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 24 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0