AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i104_Cobalt_Transport_aful_reg_100.orf -o104_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG13761 100 Archaeoglobus_fulgidus Motif number 1 TTTAACTGAGTTTAGAGTTGCAGCA 1 3 0 TTTGAGTGAG 0.998146 -98 ATTTAAATTTTTTGGATTTTCAGTAAGATTTAT 1 35 0 TTTGATTTAG 0.988805 -66 CCTCCAGATTTCTTGAGCTTGTGTCAGATTGAC 1 71 0 TCTGAGTTTG 0.998162 -30 GCTCAAGAAATCTGGAGGTGTTGTG 1 86 1 TCTGAGTGTG 0.998811 -15 *** *** ** ** Masking position 6 Map Score: 5.25883 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 85 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ATTTTCAGTAAGATTTATTTAACTGAGTTT 1 23 0 AGATTTATTT 0.977282 -78 GACTTTATTTAAATTTTTTGGATTTTCAGT 1 44 0 AAATTTTTTG 0.964505 -57 AGCTTGTGTCAGATTGACTTTATTTAAATT 1 59 0 AGATTGACTT 0.97655 -42 CAACACCTCCAGATTTCTTGAGCTTGTGTC 1 79 0 AGATTTCTTG 0.993903 -22 ********** Masking position 5 Map Score: 4.01642 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 65 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AGTAAGATTTATTTAACTGAGTTTAGAGTT 1 17 0 ATTTAACTGA 0.996141 -84 AGTTAAATAAATCTTACTGAAAATCCAAAA 1 29 1 ATCTTACTGA 0.991924 -72 AATCCAAAAAATTTAAATAAAGTCAATCTG 1 50 1 ATTTAAATAA 0.971804 -51 ********** Masking position 6 Map Score: 2.40182 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 2 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0