AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i104_Cobalt_Transport_aful_reg_300.orf -o104_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG13761 100 Archaeoglobus_fulgidus Motif number 1 TGCTGCAACTCTAAACTCAGTTAAA 1 3 1 CTCACTCAAA 0.998124 -98 ATAAATCTTACTGAAAATCCAAAAAATTTAAAT 1 35 1 CTAAATCAAA 0.988675 -66 GTCAATCTGACACAAGCTCAAGAAATCTGGAGG 1 71 1 CAAACTCAGA 0.99814 -30 CACAACACCTCCAGATTTCTTGAGC 1 86 0 CACACTCAGA 0.998797 -15 ** ** *** *** Masking position 8 Map Score: 5.25883 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 85 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ATTTTCAGTAAGATTTATTTAACTGAGTTT 1 23 0 AGATTTATTT 0.975099 -78 GACTTTATTTAAATTTTTTGGATTTTCAGT 1 44 0 AAATTTTTTG 0.971173 -57 AGCTTGTGTCAGATTGACTTTATTTAAATT 1 59 0 AGATTGACTT 0.980825 -42 CAACACCTCCAGATTTCTTGAGCTTGTGTC 1 79 0 AGATTTCTTG 0.995127 -22 ********** Masking position 5 Map Score: 4.01642 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 65 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AACTCTAAACTCAGTTAAATAAATCTTACT 1 17 1 TCAGTTAAAT 0.996509 -84 TTTTGGATTTTCAGTAAGATTTATTTAACT 1 29 0 TCAGTAAGAT 0.992687 -72 CAGATTGACTTTATTTAAATTTTTTGGATT 1 50 0 TTATTTAAAT 0.974394 -51 ********** Masking position 7 Map Score: 2.40182 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 2 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0