AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i111_Amino_Acid_Transport_2_aful_reg_100.orf -o111_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG47603 30 Archaeoglobus_fulgidus #2 RAG47602 57 Archaeoglobus_fulgidus #3 RAG47874 261 Archaeoglobus_fulgidus Motif number 1 ATTTGAATTTTTGTCGTTCAACTAT 2 43 0 AATTTTTGTC 0.98198 -15 AGCATTTTGGTTCAAACAATTC 3 3 1 CATTTTGGTT 0.949212 -259 TGGTTCAAACAATTCTGGTCTGTGCGGTTA 3 18 1 AATTCTGGTC 0.99574 -244 GCAACTTGGAAATTCTCGTCAGAGAAGCTC 3 57 0 AATTCTCGTC 0.988661 -205 AAAGATGTGCATTTTTGGTCCATTTTTCCA 3 172 0 ATTTTTGGTC 0.985032 -90 ********** Masking position 6 Map Score: 6.33431 Number of sites scoring better than the average of aligned sites = 156 Number in coding regions = 57 Number in noncoding regions = 99 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 CCATATATACTGCGATGGCTTCTTG 1 6 1 TATACTGCGA 0.955918 -25 ATAAAGGATTTTATCTGCAAAGGGCGAAGG 3 116 0 TTATCTGCAA 0.969857 -146 ATAATGAACTTAATCTGGAAAAATGGACCA 3 157 1 TAATCTGGAA 0.985332 -105 GGGGAGTATATAACCTGGGAGAAAGAAAGA 3 197 0 TAACCTGGGA 0.988675 -65 CTCTCATGCCTTAACTGGCAGCGGGGAGTA 3 219 0 TTAACTGGCA 0.975252 -43 ********** Masking position 6 Map Score: 2.7596 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 64 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 GATAACAAGAAGCCATCGCA 1 21 0 GATAACAAGA 0.976558 -10 TCGGAAGTCTGAGAAAAGGAGCAACTTGGA 3 77 0 GAGAAAAGGA 0.972237 -185 CATTATAGATGAAAACAATAAAGGATTTTA 3 133 0 GAAAACAATA 0.9023 -129 ACTTAATCTGGAAAAATGGACCAAAAATGC 3 164 1 GAAAAATGGA 0.969695 -98 TAACCTGGGAGAAAGAAAGATGTGCATTTT 3 187 0 GAAAGAAAGA 0.969208 -75 GAGGAATTTGGATTGCTGGACTCGTA 3 246 1 GATTGCTGGA 0.877729 -16 ********** Masking position 2 Map Score: 2.56515 Number of sites scoring better than the average of aligned sites = 625 Number in coding regions = 567 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 4 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0