AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i117_Oligopeptide_Transport_aful_reg_100.orf -o117_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG45695 300 Archaeoglobus_fulgidus Motif number 1 ACAAGAAAAAGGAAGAGAGGCTTTAGCATCA 1 39 1 GGAAGAGGGC 0.999584 -262 AATAATTAACGGAAGAGTGGCACTACACGTT 1 69 0 GGAAGAGGGC 0.999563 -232 TTATCTGAGGGAAAGAGGGGCACATTGTTGT 1 210 0 GAAAGAGGGC 0.998869 -91 ******* *** Masking position 6 Map Score: 7.13504 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 16 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TCATGAAACAAGAAAAAGGAAGAGAGGCTT 1 32 1 AGAAAAAGGA 0.952924 -269 TTATTTCTCCCGAAATCGACATGGTTCTTT 1 95 1 CGAAATCGAC 0.970769 -206 AAAACGATAGTGAAAAAGAACCATGTCGAT 1 109 0 TGAAAAAGAA 0.927918 -192 TGAGAAGGCTCGAAAACGATAGTGAAAAAG 1 121 0 CGAAAACGAT 0.986617 -180 AATCTTCAGGCGATAAAGGTACAACAATGT 1 190 1 CGATAAAGGT 0.957278 -111 CCGGCAGTGACGACATCGGATACGTTTGAG 1 258 0 CGACATCGGA 0.975671 -43 ********** Masking position 5 Map Score: 3.29407 Number of sites scoring better than the average of aligned sites = 492 Number in coding regions = 457 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 TTTCGAGCCTTCTCAGAAGTGCCATGAGCT 1 136 1 TCTCAGAAGT 0.926286 -165 GTGCCATGAGCTTCAAACGTGCATCTGATG 1 154 1 CTTCAAACGT 0.97977 -147 GATTGTATTTCATCAGATGCACGTTTGAAG 1 164 0 CATCAGATGC 0.954877 -137 GAAATACAATCTTCAGGCGATAAAGGTACA 1 183 1 CTTCAGGCGA 0.97338 -118 CCCCTCTTTCCCTCAGATAAATTTTTAAGC 1 221 1 CCTCAGATAA 0.939301 -80 AAGCCAAACACCTCAAACGTATCCGATGTC 1 247 1 CCTCAAACGT 0.990919 -54 ********** Masking position 5 Map Score: 2.9776 Number of sites scoring better than the average of aligned sites = 429 Number in coding regions = 404 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 GATAGTGAAAAAGAACCATGTCGATTTCGG 1 104 0 AAGAACCATG 0.995426 -197 GCCTTCTCAGAAGTGCCATGAGCTTCAAAC 1 142 1 AAGTGCCATG 0.99037 -159 TAAAAACCTTGTTATTATGTA 1 290 0 AAAAACCTTG 0.978305 -11 ********** Masking position 2 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 48 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0