AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i119_Spermidine_putrescine_Transport_aful_reg_300.orf -o119_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG47245 31 Archaeoglobus_fulgidus #2 RAG47166 300 Archaeoglobus_fulgidus Motif number 1 AAGTCGCTTTTAAGGACATTTTCCACTCTTTT 2 75 0 TAAGCATTTT 0.992978 -226 TTTAGTTTTAAAAGGACAGTTTTTAGATTTTC 2 115 0 AAAGCAGTTT 0.957861 -186 CTTTTAAAACTAAAATCATTATCCAAGGTCTG 2 133 1 TAAACATTAT 0.934479 -168 TATGCCAATTAAAGCTCTTTTTTCTGCGTAAA 2 195 1 AAAGCTTTTT 0.961934 -106 ATAAACATTCTAAATGCTTTTTACGCAGAAAA 2 214 0 TAAACTTTTT 0.623745 -87 AACTTTCGTGTCAGCCCAATTTTTTATCTAAT 2 250 0 TCAGCAATTT 0.959787 -51 AGAACACAATCAATCCATTTTGTATAAAAAA 2 280 0 TCAACATTTT 0.977471 -21 **** ****** Masking position 3 Map Score: 6.31898 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 123 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 CTTTTAAGGACATTTTCCACTCTTTTGGAC 2 71 0 CATTTTCCAC 0.978661 -230 ACAGTTTTTAGATTTTCAAAAACCAAAGTC 2 102 0 GATTTTCAAA 0.989902 -199 AAACTAAAATCATTATCCAAGGTCTGATAA 2 139 1 CATTATCCAA 0.957931 -162 TTGAAAATCAGAATTTCAAAAATTTATCAG 2 162 0 GAATTTCAAA 0.9603 -139 TTGAAATTCTGATTTTCAATTTTATGCCAA 2 173 1 GATTTTCAAT 0.974875 -128 CATTTAGAATGTTTATCAACATTAGATAAA 2 230 1 GTTTATCAAC 0.914439 -71 ********** Masking position 6 Map Score: 6.13822 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 130 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 TGGGAGTCTAGCCAACTTTT 2 1 0 GCCAACTTTT 0.972397 -300 GTTTTAAAAGGACAGTTTTTAGATTTTCAA 2 113 0 GACAGTTTTT 0.975944 -188 TCCAAGGTCTGATAAATTTTTGAAATTCTG 2 154 1 GATAAATTTT 0.921896 -147 GCCAATTAAAGCTCTTTTTTCTGCGTAAAA 2 198 1 GCTCTTTTTT 0.897514 -103 TTTCGTGTCAGCCCAATTTTTTATCTAATG 2 249 0 GCCCAATTTT 0.972062 -52 GGGCTGACACGAAAGTTTTTTATACAAAAT 2 265 1 GAAAGTTTTT 0.904584 -36 ********** Masking position 7 Map Score: 2.67571 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 168 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0