AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i122_Arsenical_Resistance_Pump_aful_reg_100.orf -o122_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG31144 182 Archaeoglobus_fulgidus Motif number 1 TGGGACACTTCCTACAAATCACCGAATCGT 1 12 1 CCTACAAATC 0.9697 -171 GGCAGAACTCCCAAAAAATTTAAATCACGA 1 38 0 CCAAAAAATT 0.985346 -145 TAAAACTTAACCAAAAACGAAGTCAGGCAG 1 63 0 CCAAAAACGA 0.943206 -120 TAACTTTAAACCTAAAACTTAACCAAAAAC 1 75 0 CCTAAAACTT 0.993443 -108 CAAGCTGATTCAGAAAACTTTATCAAATCC 1 105 1 CAGAAAACTT 0.949026 -78 TCATGATTTTCCTAAAAATCGGATTTGATA 1 125 0 CCTAAAAATC 0.990477 -58 TTAGGAAAATCATGAAAAGTTGTAAAGCTA 1 140 1 CATGAAAAGT 0.876331 -43 ********** Masking position 6 Map Score: 9.19732 Number of sites scoring better than the average of aligned sites = 345 Number in coding regions = 275 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 2 CCAAAAAATTTAAATCACGATTCGGTGATT 1 28 0 TAAATCACGA 0.980901 -155 TTTTAGGTTTAAAGTTACAAGCTGATTCAG 1 88 1 AAAGTTACAA 0.970294 -95 GATTTTTAGGAAAATCATGAAAAGTTGTAA 1 135 1 AAAATCATGA 0.970294 -48 GAAAAGTTGTAAAGCTACGAAAATTGAAGC 1 153 1 AAAGCTACGA 0.987034 -30 ********** Masking position 7 Map Score: 1.55218 Number of sites scoring better than the average of aligned sites = 114 Number in coding regions = 103 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ACCGAATCGTGATTTAAATTTTTTGGGAGT 1 32 1 GATTTAAATT 0.911494 -151 AGTTCTGCCTGACTTCGTTTTTGGTTAAGT 1 59 1 GACTTCGTTT 0.965587 -124 CTTCGTTTTTGGTTAAGTTTTAGGTTTAAA 1 71 1 GGTTAAGTTT 0.942824 -112 TTAAGTTTTAGGTTTAAAGTTACAAGCTGA 1 83 1 GGTTTAAAGT 0.969459 -100 TGTGAGCACGGCTTCAATTTTCGTAGCTT 1 164 0 GGCTTCAATT 0.988192 -19 ********** Masking position 4 Map Score: 2.44508 Number of sites scoring better than the average of aligned sites = 116 Number in coding regions = 97 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0