AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i155_Hydrogenase_2_aful_reg_100.orf -o155_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48483 139 Archaeoglobus_fulgidus Motif number 1 TTGAAAAAAGTTAATAAATTAATATGTTAA 1 18 0 TTAATAAATT 0.92035 -122 CAATTTTTAGTTGAAAAAAGTTAATAAATT 1 28 0 TTGAAAAAAG 0.928984 -112 CTTTTTTCAACTAAAAATTGCACAATTTTT 1 38 1 CTAAAAATTG 0.979645 -102 AATAGATGCATGAAAAATTGTGCAATTTTT 1 50 0 TGAAAAATTG 0.990638 -90 ATTGTAAAAGTTAATAGATGCATGAAAAAT 1 62 0 TTAATAGATG 0.964802 -78 ATTACATACATGAAAAATTGTAAAAGTTAA 1 78 0 TGAAAAATTG 0.990638 -62 ATGTAATTATTTATAAAATGATTTAAAGCT 1 101 1 TTATAAAATG 0.977015 -39 ********** Masking position 6 Map Score: 9.92246 Number of sites scoring better than the average of aligned sites = 326 Number in coding regions = 229 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 105 Fraction of orfs with sites within 600 bp upstream = 0.0168648 Motif number 2 TAGTTAACATATTAATTTATTAACTTTTTT 1 15 1 ATTAATTTAT 0.861246 -125 TATTAACTTTTTTCAACTAAAAATTGCACA 1 32 1 TTTCAACTAA 0.923897 -108 TTGCACAATTTTTCATGCATCTATTAACTT 1 55 1 TTTCATGCAT 0.943352 -85 TTTTACAATTTTTCATGTATGTAATTATTT 1 83 1 TTTCATGTAT 0.942706 -57 GAATTCCAGCTTTAAATCATTTTATAAATA 1 108 0 TTTAAATCAT 0.957392 -32 ********** Masking position 5 Map Score: 3.37468 Number of sites scoring better than the average of aligned sites = 197 Number in coding regions = 171 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0