AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_Biotin_Biosynthesis_aful_reg_100.orf -o174_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48329 192 Archaeoglobus_fulgidus #2 RAG47341 128 Archaeoglobus_fulgidus Motif number 1 GGCTAAGCTGTAAATCGTTTTCGGTGCCTTAGATAA 1 25 1 TAAATCGTTG 0.97472 -168 TTTATTTCGATAAATTGTTATCTAAGGCACCGAAAA 1 42 0 TAAATTGTTG 0.880795 -151 TTTATCGAAATAAATAAAATTCTCGGCAACTGCTAC 1 64 1 TAAATAAATG 0.982012 -129 TGCTACAAATCAAATACGTATTCTTGTTGCAATTAC 1 94 1 CAAATACGTG 0.939311 -99 AAGAATACGTAAAATCCAAGTAATTGCAACAAGAAT 1 113 0 AAAATCCATG 0.974397 -80 AACCTTTTTTCAAATAGAACTGCAAGAATACGTAAA 1 136 0 CAAATAGATG 0.987643 -57 ATGGCAGTATCAAATCAAGGTGATGGT 2 2 0 CAAATCAATG 0.990592 -127 GCCATCAACCTAAATAAACTTTCCTGAAGAACGTAA 2 33 1 TAAATAAATG 0.982032 -96 TGCACCTCAAAAGATCAAGATTTACGTTCTTCAGGA 2 54 0 AAGATCAATG 0.916124 -75 ******** * * Masking position 11 Map Score: 6.76453 Number of sites scoring better than the average of aligned sites = 171 Number in coding regions = 147 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 TTTACAGCTTAGCCTAATGTCAGCAGTG 1 7 0 AGCCTATGCA 0.997459 -186 CCAGTTTTAAGGCTAAAGCCACCGATTTAAA 1 172 0 AGGCTAAGCA 0.933821 -21 AAGTTTATTTAGGTTGATGGCAGTATCAAATC 2 22 0 AGGTTATGCA 0.991457 -107 GTCTCAAGCCTGATGGGAAATACAAAAA 2 111 0 AGCCTATGGA 0.994147 -18 ***** *** ** Masking position 7 Map Score: 3.35262 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 25 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 AACAATTTATCGAAATAAATAAAATTCTCGG 1 59 1 CGAATAAATA 0.954097 -134 GCAACTGCTACAAATCAAATACGTATTCTTG 1 89 1 CAATCAAATA 0.978032 -104 AGAATACGTAAAATCCAAGTAATTGCAACAA 1 117 0 AAACCAAGTA 0.911189 -76 CTAAAGCCACCGATTTAAAAACCTTTTTTCA 1 160 0 CGATTAAAAA 0.917628 -33 ATACTGCCATCAACCTAAATAAACTTTCCTG 2 28 1 CAACTAAATA 0.970883 -101 AAGCAATATTAAAAACAAAAAATTTTTGTAT 2 89 1 AAAACAAAAA 0.95955 -40 GCCTGATGGGAAATACAAAAATTTTTTGTTT 2 101 0 AAAACAAAAA 0.95955 -28 *** ******* Masking position 7 Map Score: 3.7714 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 118 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 4 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0