AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_Biotin_Biosynthesis_aful_reg_300.orf -o174_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48329 192 Archaeoglobus_fulgidus #2 RAG47341 128 Archaeoglobus_fulgidus Motif number 1 GGCTAAGCTGTAAATCGTTTTCGGTGCCTTAGATAA 1 25 1 TAAATCGTTG 0.972324 -168 TTTATTTCGATAAATTGTTATCTAAGGCACCGAAAA 1 42 0 TAAATTGTTG 0.870678 -151 TTTATCGAAATAAATAAAATTCTCGGCAACTGCTAC 1 64 1 TAAATAAATG 0.980317 -129 TGCTACAAATCAAATACGTATTCTTGTTGCAATTAC 1 94 1 CAAATACGTG 0.934668 -99 AAGAATACGTAAAATCCAAGTAATTGCAACAAGAAT 1 113 0 AAAATCCATG 0.972053 -80 AACCTTTTTTCAAATAGAACTGCAAGAATACGTAAA 1 136 0 CAAATAGATG 0.986463 -57 ATGGCAGTATCAAATCAAGGTGATGGT 2 2 0 CAAATCAATG 0.989685 -127 GCCATCAACCTAAATAAACTTTCCTGAAGAACGTAA 2 33 1 TAAATAAATG 0.980335 -96 TGCACCTCAAAAGATCAAGATTTACGTTCTTCAGGA 2 54 0 AAGATCAATG 0.908695 -75 ******** * * Masking position 11 Map Score: 6.76453 Number of sites scoring better than the average of aligned sites = 171 Number in coding regions = 147 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 CACTGCTGACATTAGGCTAAGCTGTAAA 1 7 1 TGCATAGGCT 0.997364 -186 TTTAAATCGGTGGCTTTAGCCTTAAAACTGG 1 172 1 TGCTTAGCCT 0.936425 -21 GATTTGATACTGCCATCAACCTAAATAAACTT 2 22 1 TGCATAACCT 0.991002 -107 TTTTTGTATTTCCCATCAGGCTTGAGAC 2 111 1 TCCATAGGCT 0.993842 -18 ** *** ***** Masking position 6 Map Score: 3.35262 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 25 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 CCGAGAATTTTATTTATTTCGATAAATTGTT 1 59 0 TATTTATTCG 0.949792 -134 CAAGAATACGTATTTGATTTGTAGCAGTTGC 1 89 0 TATTTGATTG 0.975915 -104 TTGTTGCAATTACTTGGATTTTACGTATTCT 1 117 1 TACTTGGTTT 0.903269 -76 TGAAAAAAGGTTTTTAAATCGGTGGCTTTAG 1 160 1 TTTTTAATCG 0.910225 -33 CAGGAAAGTTTATTTAGGTTGATGGCAGTAT 2 28 0 TATTTAGTTG 0.9681 -101 ATACAAAAATTTTTTGTTTTTAATATTGCTT 2 89 0 TTTTTGTTTT 0.955733 -40 AAACAAAAAATTTTTGTATTTCCCATCAGGC 2 101 1 TTTTTGTTTT 0.955733 -28 ******* *** Masking position 5 Map Score: 3.7714 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 118 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 4 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0