AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i176_cobalamin_biosynthesis_1_aful_reg_100.orf -o176_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG13740 100 Archaeoglobus_fulgidus Motif number 1 CACAACACCTCCAGATTTCTTGAGC 1 3 1 CACACTCAGA 0.998825 -98 GTCAATCTGACACAAGCTCAAGAAATCTGGAGG 1 18 0 CAAACTCAGA 0.998183 -83 ATAAATCTTACTGAAAATCCAAAAAATTTAAAT 1 54 0 CTAAATCAAA 0.988936 -47 TGCTGCAACTCTAAACTCAGTTAAA 1 86 0 CTCACTCAAA 0.998167 -15 ** ** *** *** Masking position 8 Map Score: 5.25883 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 85 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 GACACAAGCTCAAGAAATCTGGAGGTGTTG 1 13 0 CAAGAAATCT 0.994451 -88 AATTTAAATAAAGTCAATCTGACACAAGCT 1 33 0 AAGTCAATCT 0.978473 -68 ACTGAAAATCCAAAAAATTTAAATAAAGTC 1 48 0 CAAAAAATTT 0.967491 -53 AAACTCAGTTAAATAAATCTTACTGAAAAT 1 69 0 AAATAAATCT 0.976513 -32 ********** Masking position 6 Map Score: 4.01642 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 65 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AATCCAAAAAATTTAAATAAAGTCAATCTG 1 42 0 ATTTAAATAA 0.969042 -59 AGTTAAATAAATCTTACTGAAAATCCAAAA 1 63 0 ATCTTACTGA 0.991107 -38 AGTAAGATTTATTTAACTGAGTTTAGAGTT 1 75 1 ATTTAACTGA 0.995748 -26 ********** Masking position 6 Map Score: 2.40182 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 2 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0