AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i176_cobalamin_biosynthesis_1_aful_reg_300.orf -o176_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG13740 100 Archaeoglobus_fulgidus Motif number 1 GCTCAAGAAATCTGGAGGTGTTGTG 1 3 0 TCTGAGTGTG 0.998875 -98 CCTCCAGATTTCTTGAGCTTGTGTCAGATTGAC 1 18 1 TCTGAGTTTG 0.998261 -83 ATTTAAATTTTTTGGATTTTCAGTAAGATTTAT 1 54 1 TTTGATTTAG 0.989405 -47 TTTAACTGAGTTTAGAGTTGCAGCA 1 86 1 TTTGAGTGAG 0.998244 -15 *** *** ** ** Masking position 6 Map Score: 5.25883 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 85 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 CAACACCTCCAGATTTCTTGAGCTTGTGTC 1 13 1 AGATTTCTTG 0.994689 -88 AGCTTGTGTCAGATTGACTTTATTTAAATT 1 33 1 AGATTGACTT 0.979304 -68 GACTTTATTTAAATTTTTTGGATTTTCAGT 1 48 1 AAATTTTTTG 0.968788 -53 ATTTTCAGTAAGATTTATTTAACTGAGTTT 1 69 1 AGATTTATTT 0.976083 -32 ********** Masking position 5 Map Score: 4.01642 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 65 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 CAGATTGACTTTATTTAAATTTTTTGGATT 1 42 1 TTATTTAAAT 0.970805 -59 TTTTGGATTTTCAGTAAGATTTATTTAACT 1 63 1 TCAGTAAGAT 0.991629 -38 AACTCTAAACTCAGTTAAATAAATCTTACT 1 75 0 TCAGTTAAAT 0.995999 -26 ********** Masking position 7 Map Score: 2.40182 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 2 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0