AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i179_folate_biosynthesis_aful_reg_100.orf -o179_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG46815 38 Archaeoglobus_fulgidus #2 RAG26652 64 Archaeoglobus_fulgidus Motif number 1 AAACTTGAAATATAACTTTTTGC 1 3 0 TAAACTTTTT 0.977686 -36 AGATAACTCTTAAAACCTTTGCCTTCTTACG 2 17 0 TAAACCTTTG 0.993988 -48 ACCTCAGGCGTAGAACTTCTGAGATAACTCT 2 38 0 TAAACTTCTG 0.934207 -27 GATATCACCTCAGGCGTAGAACT 2 52 0 TACACCTCAG 0.992589 -13 ** ******** Masking position 5 Map Score: 5.39823 Number of sites scoring better than the average of aligned sites = 60 Number in coding regions = 51 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 TCAAGTTTCTGTGAGGTGGACAC 1 26 1 GTGAGGTGGA 0.997431 -13 GTGTGGCGTAAGAAGGCAAA 2 1 1 GTGTGGCGTA 0.998605 -64 GATATCACCTCAGGCGTAGAACTTCTGA 2 47 0 CTCAGGCGTA 0.997313 -18 ********** Masking position 10 Map Score: 3.54156 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 34 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0