AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i179_folate_biosynthesis_aful_reg_300.orf -o179_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG46815 38 Archaeoglobus_fulgidus #2 RAG26652 64 Archaeoglobus_fulgidus Motif number 1 GCAAAAAGTTATATTTCAAGTTT 1 3 1 AAAAAGTTTA 0.978978 -36 CGTAAGAAGGCAAAGGTTTTAAGAGTTATCT 2 17 1 CAAAGGTTTA 0.993809 -48 AGAGTTATCTCAGAAGTTCTACGCCTGAGGT 2 38 1 CAGAAGTTTA 0.925294 -27 AGTTCTACGCCTGAGGTGATATC 2 52 1 CTGAGGTGTA 0.993668 -13 ******** ** Masking position 7 Map Score: 5.39823 Number of sites scoring better than the average of aligned sites = 60 Number in coding regions = 51 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 GTGTCCACCTCACAGAAACTTGA 1 26 0 TCCACCTCAC 0.99754 -13 TTTGCCTTCTTACGCCACAC 2 1 0 TACGCCACAC 0.998665 -64 TCAGAAGTTCTACGCCTGAGGTGATATC 2 47 1 TACGCCTGAG 0.997427 -18 ********** Masking position 9 Map Score: 3.54156 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 34 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 GTGTGGCGTAAGAAGGCAAAGG 2 3 1 GTGGCGTAAG 0.992219 -62 GTGGCGTAAGAAGGCAAAGGTTTTAAGAGT 2 13 1 AAGGCAAAGG 0.989282 -52 GATATCACCTCAGGCGTAGAACTTCTGAGA 2 45 0 CAGGCGTAGA 0.995818 -20 ********** Masking position 8 Map Score: 0.0919171 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 311 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0