AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i182_riboflafin_biosynthesis_aful_reg_300.orf -o182_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG31059 91 Archaeoglobus_fulgidus #2 RAG30868 101 Archaeoglobus_fulgidus #3 RAG45953 33 Archaeoglobus_fulgidus #4 RAG16256 93 Archaeoglobus_fulgidus #5 RAG16058 122 Archaeoglobus_fulgidus Motif number 1 TTTCAAAAGAACGAAACATTTAAAAATCTTTTTTCT 1 13 1 AAACTAAAAA 0.974275 -79 AATAGCCCTAAGGCAACCTTCAATAGAGAAAAAAGA 1 39 0 AAACTAATAG 0.81906 -53 AGGTTGCCTTAGGGCTATTTTAAAAAGCAAAAACAA 1 56 1 ACTATAAAAA 0.937824 -36 GGTTTTATTTCAAGTACAAAAACGTTTGTAAG 2 7 1 ACAATAAAAA 0.988259 -95 GTTGAAATAGAGTTCCCTTACAAACGTTTTTGTACT 2 23 0 ACCCTAAACG 0.923839 -79 AGGGAACTCTATTTCAACTCGAAAAATGCAGGTTTG 2 41 1 ACAATAAAAA 0.988258 -61 GGATACTTTTATTACACCTGAAATCAAACTCCCACC 2 76 1 ACACTAATCA 0.941326 -26 TCATATATGAGAAGCACCTCAAAAAATTTAAAGGTT 4 67 0 GCACTAAAAA 0.965508 -27 AAAAAATTTTAAAACCAATGCAAAAATTTCGAATC 5 10 0 ACCATAAAAA 0.976271 -113 TGTCACGGATAATAAAAATTCAAAAAATTTTAAAAC 5 31 0 AAAATAAAAA 0.959594 -92 * *** * ***** Masking position 9 Map Score: 9.98082 Number of sites scoring better than the average of aligned sites = 225 Number in coding regions = 167 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 2 ACATTTAAAAATCTTTTTTCTCTATTGAAG 1 28 1 ATCTTTTTTC 0.963541 -64 TTCCCTTACAAACGTTTTTGTACTTGAAAT 2 17 0 AACGTTTTTG 0.975106 -85 TCCCCCGACCAACTTTTTTC 3 24 1 AACTTTTTTC 0.990751 -10 AAAAACCTTTAAATTTTTTGAGGTGCTTCT 4 64 1 AAATTTTTTG 0.985533 -30 GATTCGAAATTTTTGCATTGGTTTTA 5 7 1 AAATTTTTGC 0.961405 -116 ATTGGTTTTAAAATTTTTTGAATTTTTATT 5 27 1 AAATTTTTTG 0.985533 -96 ********** Masking position 5 Map Score: 9.39396 Number of sites scoring better than the average of aligned sites = 111 Number in coding regions = 70 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 3 GTTTTTGTACTTGAAATAAAACC 2 3 0 TTGAATAAAA 0.965426 -99 TTGATTTCAGGTGTAATAAAAGTATCCAAAC 2 72 0 GTGAATAAAA 0.987754 -30 AAGTTGGTCGGGGGAATATAAACTTAAT 3 8 0 GGGAATATAA 0.972895 -26 AGTAGTCCAGAGCCAATAAAAGCCTTCCTCA 4 17 1 AGCAATAAAA 0.883683 -77 ACGATGGTTCGTGATATAAAAACCTTTAAAT 4 47 1 GTGTATAAAA 0.973276 -47 ATTTTTGCATTGGTTTTAAAATTTTTTGAAT 5 19 1 TGGTTTAAAA 0.840608 -104 AATCTGTCACGGATAATAAAAATTCAAAAAA 5 40 0 GGAAATAAAA 0.963886 -83 *** ******* Masking position 8 Map Score: 4.97552 Number of sites scoring better than the average of aligned sites = 178 Number in coding regions = 141 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 4 ********** No masking Map Score: -7.64954e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.64954e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.64954e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0