AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_aful_reg_100.orf -o194_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG17482 60 Archaeoglobus_fulgidus #2 RAG17481 39 Archaeoglobus_fulgidus Motif number 1 CCCCACCAAAAGGAAATGGTAGGGCAGGCA 1 27 1 AGGAAATGGT 0.998067 -34 ATGGTAGGGCAGGCATCGGTGAGAGGAGC 1 42 1 AGGCATCGGT 0.997748 -19 GAGGAAAAGGTTAAGAGGCAA 2 29 0 AGGAAAAGGT 0.998455 -11 ********** Masking position 5 Map Score: 5.88794 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 ATTTCCTTTTGGTGGGGCTGTGTAAAAAAT 1 14 0 GGTGGGGCTG 0.999636 -47 AAAAGGAAATGGTAGGGCAGGCATCGGTGA 1 34 1 GGTAGGGCAG 0.999461 -27 ********** Masking position 3 Map Score: 2.96342 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 28 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 GCTCCTCTCACCGATGCCTGCCC 1 48 0 CCTCTCACCG 0.998679 -13 CTTTATTTTGCCTCTTAACCTTTTCCTC 2 22 1 CCTCTTAACC 0.997324 -18 ********** Masking position 5 Map Score: 0.341791 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 15 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 TGGGGCTGTGTAAAAAATTTT 1 2 0 TAAAAAATTT 0.978902 -59 AGAGGCAAAATAAAGAGTTTTCTGAG 2 7 0 TAAAGAGTTT 0.989848 -33 GAGGAAAAGGTTAAGAGGCAAAA 2 27 0 GAAAAGGTTA 0.979406 -13 ********** Masking position 4 Map Score: 0.387054 Number of sites scoring better than the average of aligned sites = 125 Number in coding regions = 81 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0