AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_aful_reg_300.orf -o194_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG17482 60 Archaeoglobus_fulgidus #2 RAG17481 39 Archaeoglobus_fulgidus Motif number 1 TGCCTGCCCTACCATTTCCTTTTGGTGGGG 1 27 0 ACCATTTCCT 0.998 -34 GCTCCTCTCACCGATGCCTGCCCTACCAT 1 42 0 ACCGATGCCT 0.997624 -19 TTGCCTCTTAACCTTTTCCTC 2 29 1 ACCTTTTCCT 0.998365 -11 ********** Masking position 1 Map Score: 5.88794 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GCCCCACCAAAAGGAAATGGTAGGGCAGGC 1 26 1 AAGGAAATGG 0.991026 -35 AATGGTAGGGCAGGCATCGGTGAGAGGAGC 1 41 1 CAGGCATCGG 0.993269 -20 AAAAGGTTAAGAGGCAAAATAAAGAGTTTT 2 16 0 GAGGCAAAAT 0.98115 -24 GAGGAAAAGGTTAAGAGGCA 2 30 0 GAGGAAAAGG 0.998121 -10 ********** Masking position 6 Map Score: 3.94445 Number of sites scoring better than the average of aligned sites = 758 Number in coding regions = 718 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 3 GGGGCTGTGTAAAAAATTTT 1 1 0 AAAAAATTTT 0.613404 -60 GAGGCAAAATAAAGAGTTTTCTGAG 2 6 0 AAAGAGTTTT 0.880819 -34 GAGGAAAAGGTTAAGAGGCAAAAT 2 26 0 AAAAGGTTAA 0.959902 -14 ********** Masking position 3 Map Score: 0.387054 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 93 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 4 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0