AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_aful_reg_100.orf -o198_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50329 222 Archaeoglobus_fulgidus #2 RAG25938 75 Archaeoglobus_fulgidus Motif number 1 ATGTTCCTTCCGCGGAAGGCTAAAAACGATT 1 30 0 CGCGGAAGGT 0.992466 -193 TTTAAATCTTTGCCGCATGTTAATTTTTAAT 1 59 0 TGCCGCATGT 0.980554 -164 GTCAAAACTACGCTGAGGTGTAGTTGATATG 1 105 1 CGCTGAGGTT 0.979248 -118 TGGCGCCTCATTTTTTGCTGACTC 1 209 0 CGCCTCATTT 0.969761 -14 GCGTCCCGAACGCCGCAGGATCACCAGG 2 8 0 CGCCGCAGGT 0.998613 -68 CAGATGGGGCCGCCGAGATTTGAACTCGGGT 2 43 0 CGCCGAGATT 0.984122 -33 ********* * Masking position 11 Map Score: 5.90375 Number of sites scoring better than the average of aligned sites = 209 Number in coding regions = 193 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ATCGTTTTTAGCCTTCCGCGGAAGGAACAT 1 31 1 GCCTTCCGCG 0.971471 -192 GTCAAAACTACGCTGAGGTGTAGTTGATAT 1 105 1 CGCTGAGGTG 0.937978 -118 TAAGGAAGCTGGCAGAGGAGGAAGTCAAAT 1 143 1 GGCAGAGGAG 0.968343 -80 CCTCATTTTTTGCTGACTCGCTCAGCAGTA 1 198 0 TGCTGACTCG 0.930372 -25 CCTGGTGATCCTGCGGCGTTCGGGACGC 2 9 1 TCCTGCGGCG 0.975385 -67 GCGGCGTTCGGGACGCCGTGACCCGAGTTC 2 23 1 GGACGCCGTG 0.966721 -53 AAGCAGATGGGGCCGCCGAGATTTGAACTC 2 47 0 GGCCGCCGAG 0.986427 -29 ********** Masking position 10 Map Score: 5.40929 Number of sites scoring better than the average of aligned sites = 1215 Number in coding regions = 1140 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 3 TAGCTTCACCTCATATCGAAATCGTTTTT 1 10 1 CTCATATCGA 0.993151 -213 CCGCGGAAGGCTAAAAACGATTTCGATATG 1 22 0 CTAAAAACGA 0.945175 -201 TAATGTAACGGTCAAAACTACGCTGAGGTG 1 95 1 GTCAAAACTA 0.936144 -128 CCTTATCTTGCTCATATCAACTACACCTCA 1 118 0 CTCATATCAA 0.97326 -105 AGAGGAGGAAGTCAAATCCAAACCTCGTTA 1 156 1 GTCAAATCCA 0.975927 -67 AACCTCGTTACTCTCATCGATGTACTGCTG 1 176 1 CTCTCATCGA 0.967834 -47 ********** Masking position 6 Map Score: 4.82611 Number of sites scoring better than the average of aligned sites = 278 Number in coding regions = 249 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 TTTTGCTGACTCGCTCAGCAGTACATCGAT 1 191 0 TCGCTCAGCA 0.963383 -32 TGGCGCCTCATTTTTTGCTG 1 213 0 TGGCGCCTCA 0.932103 -10 CCTGCGGCGTTCGGGACGCCGTGACCCGAG 2 20 1 TCGGGACGCC 0.992949 -56 TTAAAGCAGATGGGGCCGCCGAGATTTGAA 2 50 0 TGGGGCCGCC 0.928986 -26 ********** Masking position 1 Map Score: 2.03176 Number of sites scoring better than the average of aligned sites = 62 Number in coding regions = 54 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 CAGCAAAAAATGAGGCGCCA 1 213 1 TGAGGCGCCA 0.947103 -10 CTGCGGCGTTCGGGACGCCGTGACCCGAGT 2 21 1 CGGGACGCCG 0.867027 -55 TAAAGCAGATGGGGCCGCCGAGATTTGAAC 2 49 0 GGGGCCGCCG 0.983823 -27 ********** Masking position 6 Map Score: 0.937561 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 6 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 6 ********** No masking Map Score: -5.3758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.3758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.3758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0