AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i279_hypothetical4_aful_reg_100.orf -o279_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48295 148 Archaeoglobus_fulgidus Motif number 1 CACTGTTAGGTAACAGTGTTTGGGGTGGTG 1 16 0 TAACAGTGTT 0.997421 -133 CACTGTTACCTAACAGTGTTTATATTTAAC 1 28 1 TAACAGTGTT 0.997421 -121 GTTGGCCTAAAATCGGTTTTGAAAATGCAA 1 82 0 AATCGGTTTT 0.974767 -67 GCCTAAATTTAAAAAGTTTTTGGTTGGCCT 1 104 0 AAAAAGTTTT 0.89314 -45 ATCCTAAACATAACGGTGTTAAAA 1 135 1 TAACGGTGTT 0.997609 -14 ********** Masking position 7 Map Score: 11.217 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 50 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 CCCATCACCACCCCAAACACTGTTACC 1 7 1 ACCACCCAAA 0.993305 -142 TTTTGAAAATGCAATCAAAAATGCATAATGC 1 65 0 GCAATCAAAA 0.984782 -84 CCGATTTTAGGCCAACCAAAAACTTTTTAAA 1 96 1 GCCAACCAAA 0.997492 -53 TTAAATTTAGGCTATCCTAAACATAACGGTG 1 122 1 GCTATCCAAA 0.99612 -27 ******* *** Masking position 4 Map Score: 4.33684 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 29 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 GCTTATAATGTTAAATATAAACACTGTTAG 1 37 0 TTAAATATAA 0.564238 -112 TTAGGATAGCCTAAATTTAAAAAGTTTTTG 1 112 0 CTAAATTTAA 0.566586 -37 TTAGGCTATCCTAAACATAACGGTGTTAAA 1 128 1 CTAAACATAA 0.967404 -21 ********** Masking position 5 Map Score: 2.64239 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 5 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0