AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i296_mixed11_aful_reg_300.orf -o296_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG05258 41 Archaeoglobus_fulgidus #2 RAG05274 111 Archaeoglobus_fulgidus #3 RAG26611 137 Archaeoglobus_fulgidus Motif number 1 AACTTTATGATTAAAAAGCTTTGGTTTT 1 5 0 TAAAAGTTGG 0.992419 -37 AGCTTTTTAATCATAAAGTTTAGGAGGAGAAGG 1 19 1 TATAAGTTGG 0.991409 -23 TTACGCTATATTAAAGCTTTTAGCTAATGACCAT 2 30 1 TAAAGTTTGC 0.967991 -82 AAAGGTTGCCTTATAACTATTATGGTCATTAGCT 2 51 0 TATAATTTTG 0.965812 -61 ATTTCAAGTTTAAAAACGCTTTTCAAAAGGTTGC 2 76 0 TAAAAGTTTC 0.936874 -36 GCCAACTTATTTAAAATTATTTGGAATGAACTTC 3 25 1 TAAAATTTGG 0.995769 -113 GTCATATAGGTAAAAATTTTTCGGATTAATTCCG 3 97 0 TAAAATTTGG 0.995511 -41 * **** * ** ** Masking position 5 Map Score: 11.6609 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 75 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 2 TAATTACTTTTAAGGGAGTTGG 2 3 0 TAAGGGAGTT 0.986753 -109 AGCTTTAATATAGCGTAATTACTTTTAAGG 2 18 0 TAGCGTAATT 0.979657 -94 AGAAGGCATTTAGCGGAATTAATCCGAAAA 3 84 1 TAGCGGAATT 0.9948 -54 CCCGTAGGGGAGTAGTTGTCATAT 3 124 0 TAGGGGAGTA 0.991525 -14 ********** Masking position 7 Map Score: 3.86627 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 AAAGTAATTACGCTATATTAAAGCTTTTAG 2 23 1 CGCTATATTA 0.964804 -89 TATGGTCATTAGCTAAAAGCTTTAATATAG 2 35 0 AGCTAAAAGC 0.964158 -77 CTTCTCATCGCCCAAAATTCAAACCTCACA 3 55 1 CCCAAAATTC 0.948636 -83 GGATTAATTCCGCTAAATGCCTTCTGTGAG 3 79 0 CGCTAAATGC 0.995008 -59 AAAAATTTTTACCTATATGACAACTACTCC 3 110 1 ACCTATATGA 0.948703 -28 ********** Masking position 5 Map Score: 1.98383 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 60 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0