AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i314_mixed28_aful_reg_300.orf -o314_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50267 46 Archaeoglobus_fulgidus #2 RAG23554 37 Archaeoglobus_fulgidus #3 RAG23596 126 Archaeoglobus_fulgidus #4 RAG49167 48 Archaeoglobus_fulgidus Motif number 1 GTAAAGTTTTTTTGATTCAAAT 1 1 1 GTAAATTTTT 0.937658 -46 GAAGGCATCAGAAAAAGTTGATTTGAATCAAA 1 21 0 GAAAAGTTAT 0.993402 -26 CGAAACCTTTATTTGACATGCTG 2 2 1 GAAACTTTTT 0.952814 -36 ATTCTCACCTGAAAAGGTTTTAAAGCTGACGA 3 23 0 GAAAAGTTTA 0.983373 -104 CTTTTCAGGTGAGAATTTTTAAACATAAACAA 3 39 1 GAGAATTTAA 0.921846 -88 AGAAGTTATAGATAATGTTGTTTATGTTTAAA 3 56 0 GATAAGTTTT 0.973574 -71 TCGCTATCGTGAAGAAGTTATAGATAATGTTG 3 68 0 GAAGAGTTTA 0.961665 -59 ACGATAGCGAGAAAAAGTTAATATTCTTTCAG 3 90 1 GAAAAGTTAT 0.991112 -37 CAAAACCTCGGAAAAGTGTAATAAATAACTAA 4 25 0 GAAAATGTAT 0.952542 -24 ***** *** ** Masking position 9 Map Score: 14.1849 Number of sites scoring better than the average of aligned sites = 422 Number in coding regions = 341 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 2 AATGAAGGCATCAGAAAAAGTTGATTTGAAT 1 25 0 TAGAAAAAGT 0.948507 -22 CTCAGCATGTCAAATAAAGGTTTCG 2 5 0 CAATAAAGGT 0.918301 -33 CTTTATTTGACATGCTGAGGTGGTGGGGAAC 2 17 1 CTGCTGAGGT 0.955236 -21 AAAATTCTCACCTGAAAAGGTTTTAAAGCTG 3 27 0 CTGAAAAGGT 0.99201 -100 TTCTCGCTATCGTGAAGAAGTTATAGATAAT 3 72 0 CTGAAGAAGT 0.986251 -55 TTCACGATAGCGAGAAAAAGTTAATATTCTT 3 87 1 CAGAAAAAGT 0.993974 -40 TAATAAATAACTAACTAAAGTAAGCTCG 4 8 0 CAACTAAAGT 0.919682 -41 GGCAAAACCTCGGAAAAGTGTAATAAATA 4 30 0 CCGGAAAAGT 0.970993 -19 * ********* Masking position 8 Map Score: 9.32807 Number of sites scoring better than the average of aligned sites = 571 Number in coding regions = 533 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 3 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0