AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i320_mixed5_aful_reg_300.orf -o320_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50400 138 Archaeoglobus_fulgidus #2 RAG20719 101 Archaeoglobus_fulgidus Motif number 1 ATCATAAAAAATAGGATGTTA 1 2 1 TCATAAAAAA 0.960832 -137 GTGATTACCATCATCACATATCAGTGTTAC 1 47 1 TCATCACATA 0.963214 -92 CATATCAGTGTTACCAAAACTTTTAAAACT 1 63 1 TTACCAAAAC 0.898054 -76 ATCACCTCCTTCATCAAATCATCATTCATC 1 116 0 TCATCAAATC 0.993038 -23 GTCATCACCTCCTTCATCAAA 1 128 0 TCATCACCTC 0.96725 -11 GCATAAAAACTCAAAAAAACTTTATTTGTT 2 28 0 TCAAAAAAAC 0.956871 -74 GAATTTGTGGGCATAAAAACTCAAAAAAAC 2 38 0 GCATAAAAAC 0.96512 -64 ********** Masking position 6 Map Score: 7.17702 Number of sites scoring better than the average of aligned sites = 671 Number in coding regions = 606 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 2 ACTGATATGTGATGATGGTAATCACAAGAT 1 42 0 GATGATGGTA 0.960989 -97 GGGAAGAGCCGATGAATGATGATTTGATGA 1 106 1 GATGAATGAT 0.979104 -33 ATGATGATTTGATGAAGGAGGTGATGAC 1 121 1 GATGAAGGAG 0.995049 -18 GCTGAATGTGCGCTTCAAAC 2 1 1 GCTGAATGTG 0.983201 -101 CACCCTTGCCGAAGCTTGAGC 2 91 1 GAAGCTTGAG 0.946776 -11 ********** Masking position 4 Map Score: 3.35022 Number of sites scoring better than the average of aligned sites = 887 Number in coding regions = 858 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 TAGGATGTTAATCCATTTAAATCTTGTGATT 1 22 1 ATCCTTTAAA 0.969302 -117 AGTGTTACCAAAACTTTTAAAACTGCACGGG 1 69 1 AAACTTTAAA 0.989716 -70 TGTGCGCTTCAAACAAATAAAGTTTTTTTGA 2 17 1 AAACAATAAA 0.963743 -85 GTGGGCATAAAAACTCAAAAAAACTTTATTT 2 31 0 AAACCAAAAA 0.922924 -71 TCAACTCTAAAACCTTTTAAACACCCTTGCC 2 70 1 AACCTTTAAA 0.990466 -32 **** ****** Masking position 9 Map Score: 3.07456 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 25 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 4 GCTGAATGTGCGCTTCAAACAAATA 2 6 1 ATGTGCGCTT 0.899333 -96 TTGAGCGAATTTGTGGGCATAAAAACTCAA 2 44 0 TTGTGGGCAT 0.986525 -58 GGTTTTAGAGTTGAGCGAATTTGTGGGCAT 2 54 0 TTGAGCGAAT 0.975392 -48 ********** Masking position 2 Map Score: 0.0462086 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 36 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0