AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i115_Glycine_Transport_bbur_reg_300.orf -o115_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00590 153 3615 #2 RBB00589 50 3615 Motif number 1 CTTTTGTTAATACAATTTATACCAATTAAACTA 1 16 0 TAAATATACC 0.947636 -138 AAATTGTATTAACAAAAGATCCTTTAAAGGATC 1 31 1 AAAAAATCCT 0.986086 -123 GAAATAAAAAAACAAAAGATCCTTTAAAGGATC 1 48 0 AAAAAATCCT 0.986086 -106 CAGATCGGCAAAAATTTAATAATTTTAGTATAA 1 80 1 AAATTATAAT 0.902442 -74 AACACATCATTATAAATTATACTAAAATTATTA 1 96 0 TAAATATACT 0.983222 -58 CATTATGCTTTATAACACATCATTATAAATTAT 1 109 0 TAAAAATCAT 0.978263 -45 GTCAGAAATTTAAATTTTATCATGGAGGAATGA 2 25 1 TAATTATCAT 0.962258 -26 ** ** * ***** Masking position 9 Map Score: 6.77035 Number of sites scoring better than the average of aligned sites = 385 Number in coding regions = 249 Number in noncoding regions = 136 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 ATACCAATTAAACTAGAATT 1 1 0 AACTAGAATT 0.957093 -153 TAATTGGTATAAATTGTATTAACAAAAGAT 1 21 1 AAATTGTATT 0.916202 -133 TTATAAATTATACTAAAATTATTAAATTTT 1 90 0 TACTAAAATT 0.895772 -64 ATTTTAGTATAATTTATAATGATGTGTTAT 1 101 1 AATTTATAAT 0.789504 -53 CAAAGTCAGAAATTTAAATTTTATCATGGA 2 21 1 AATTTAAATT 0.499432 -30 ********** Masking position 4 Map Score: 0.676675 Number of sites scoring better than the average of aligned sites = 806 Number in coding regions = 506 Number in noncoding regions = 300 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 3 TTATAAAGCATAATGCAGGCTTATTGAGGA 1 127 1 TAATGCAGGC 0.983282 -27 TAATGCAGGCTTATTGAGGAGTTTGCT 1 137 1 TTATTGAGGA 0.983892 -17 TTAAATTTTATCATGGAGGAATGATAT 2 34 1 TCATGGAGGA 0.936796 -17 ********** Masking position 7 Map Score: 0.340328 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 12 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 TATAAATTGTATTAACAAAAGATCCTTTAAA 1 28 1 ATTACAAAAG 0.990801 -126 TCTGAAATAAAAAAACAAAAGATCCTTTAAA 1 53 0 AAAACAAAAG 0.960355 -101 TTTATTTCAGATCGGCAAAAATTTAATAATT 1 73 1 ATCGCAAAAA 0.972457 -81 AAGGATTTGCCAAAGTCAGAAATTT 2 5 1 ATTGCCAAAG 0.971754 -46 *** ******* Masking position 8 Map Score: 0.104971 Number of sites scoring better than the average of aligned sites = 143 Number in coding regions = 100 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0