AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i191_dna_gyrase_bbur_reg_300.orf -o191_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00694 20 3615 #2 RBB00690 187 3615 Motif number 1 TTTATAAAGCAAGGATTTAG 1 1 1 TTTAAGCAAT 0.993403 -20 CTAAAAAAATTTTACATTTCTAGTATGAAAACGAAT 2 48 0 TTTATTCAAT 0.994102 -140 ATGTAAAATTTTTTTAGTTCTATAATACTTAAGCGT 2 67 1 TTTATTCAAT 0.9821 -121 AAGTTAGATATTTCAATTGCAATAATTTTTCAATTG 2 110 1 TTTATGCAAT 0.997143 -78 TGCAATAATTTTTCAATTGTGATAATTTAGTAGTTA 2 127 1 TTTATGTAAT 0.9916 -61 TTGTGATAATTTAGTAGTTAAATTATTAGTATGCTT 2 143 1 TTAATTAAAT 0.870163 -45 AAAACAACCTTTAATAAGTAAGCATACTAATAATT 2 163 0 TTTTAGTAAT 0.91425 -25 *** * *** * ** Masking position 12 Map Score: 9.00307 Number of sites scoring better than the average of aligned sites = 249 Number in coding regions = 184 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 2 ACTAAAAAAATTTTACATTTCTAGTATGAAA 2 54 0 TTTTACATTC 0.98858 -134 AATGTAAAATTTTTTTAGTTCTATAATACTT 2 66 1 TTTTTTATTC 0.982159 -122 TTAAGTTAGATATTTCAATTGCAATAATTTT 2 108 1 TATTTCATTG 0.988416 -80 ATTGCAATAATTTTTCAATTGTGATAATTTA 2 125 1 TTTTTCATTG 0.995437 -63 ******* *** Masking position 7 Map Score: 3.50205 Number of sites scoring better than the average of aligned sites = 75 Number in coding regions = 52 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 CTAAATCCTTGCTTTATAAA 1 1 0 GCTTTATAAA 0.946052 -20 ATCTCATTCTCCTTTTTTATCCATAGCGAT 2 20 1 CCTTTTTTAT 0.893654 -168 TAAGCTATACGCTTAAGTATTATAGAACTA 2 81 0 GCTTAAGTAT 0.977515 -107 TAAGCGTATAGCTTAAGTTAGATATTTCAA 2 96 1 GCTTAAGTTA 0.949833 -92 AAAACAACCTTTAATAAGTAAGCATAC 2 171 0 CCTTTAATAA 0.957377 -17 ********** Masking position 4 Map Score: 0.505727 Number of sites scoring better than the average of aligned sites = 410 Number in coding regions = 254 Number in noncoding regions = 156 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0