AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_bbur_reg_100.orf -o198_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00408 115 3615 Motif number 1 AGATTATACACAAAGCTCAC 1 1 1 AGATTATACA 0.99231 -115 TCTTTTGGAAAAATACTACACATTTAAACT 1 40 1 AAATACTACA 0.986084 -76 AAACTTTTTAACATTATACTAAAAATATAC 1 65 1 ACATTATACT 0.981133 -51 CATTATACTAAAAATATACATTAAAGTAAA 1 76 1 AAAATATACA 0.985499 -40 ACATTAAAGTAAATAATACGAGGAGTACAA 1 93 1 AAATAATACG 0.989278 -23 ********** Masking position 7 Map Score: 7.28804 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 64 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 ATTATACACAAAGCTCACAATAATAATTCT 1 13 1 AAGCTCACAA 0.981649 -103 TTTTAGTATAATGTTAAAAAGTTTAAATGT 1 59 0 ATGTTAAAAA 0.976129 -57 TTTTAACATTATACTAAAAATATACATTAA 1 70 1 ATACTAAAAA 0.918636 -46 ATATACATTAAAGTAAATAATACGAGGAGT 1 89 1 AAGTAAATAA 0.955745 -27 ATAATACGAGGAGTACAAAAA 1 105 1 GAGTACAAAA 0.963793 -11 ********** Masking position 7 Map Score: 1.93681 Number of sites scoring better than the average of aligned sites = 1204 Number in coding regions = 841 Number in noncoding regions = 363 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 3 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0