AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_transcription_translation_bbur_reg_300.orf -o211_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00509 60 3615 #2 RBB00508 79 3615 #3 RBB00505 32 3615 #4 RBB00504 148 3615 Motif number 1 TTTAATTTACATTAGAAATAATGTCAATTTAT 1 11 0 ATTAAAAAAT 0.912649 -50 CTTCCTCTTAATCTTCAATAAAGTTTAATTTA 1 34 0 ATCTCAAAAA 0.95571 -27 CTTATTATTAATTAATAAAAAACACTGACC 2 9 0 ATTATAAAAA 0.8933 -71 TAAGAAAGGATTTTATAAAAATCTACTTATTA 2 34 0 TTTTTAAAAT 0.538841 -46 TACGAATTAAATTTTTAAGAAAGGATTTTATA 2 49 0 ATTTTAAAAA 0.80948 -31 CTCTAATAAAATCAAAAAGAAAT 3 2 0 ATCAAAAAAA 0.968054 -31 AGCCTAAACCTCTAATAAAATCAAAAAGA 3 14 0 ACCTTAAAAA 0.910126 -19 TGTTACTAATAATAGTAAAAAAGAGGAAAA 4 9 0 AATATAAAAA 0.940076 -140 TTTTACTATTATTAGTAACATAATGGTGTAAT 4 21 1 ATTATAAATA 0.902517 -128 ATTTAACATTATCATTAATAATTTTATATGAT 4 55 1 ATCATAAAAT 0.678641 -94 TCCAAAAAATAATACAAAAAAATTAATACTAT 4 85 0 AATAAAAAAA 0.901077 -64 TAAGCATAACTTTTCCAAAAAATAATACAAAA 4 98 0 TTTTCAAAAA 0.859032 -51 **** *** *** Masking position 7 Map Score: 16.1267 Number of sites scoring better than the average of aligned sites = 2076 Number in coding regions = 1339 Number in noncoding regions = 737 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 2 ATAAATTGACATTATTTCTAATGT 1 4 1 AATTACATTA 0.974282 -57 AATAAAGTTTAATTTACATTAGAAATAATGT 1 19 0 AATTACATTA 0.974486 -42 GTTTTTTATTAATTAATAATAAGTAGATTTT 2 18 1 AATTATAATA 0.971072 -62 TTAAGAAAGGATTTTATAAAAATCTACTTAT 2 36 0 ATTTATAAAA 0.902623 -44 CTACGAATTAAATTTTTAAGAAAGGATTTTA 2 51 0 AATTTTAAGA 0.877299 -29 TTTCTTTTTGATTTTATTAGAGGTTTAGGCT 3 12 1 ATTTATTAGA 0.853165 -21 GGTGTAATATATTTAACATTATCATTAATAA 4 45 1 ATTTACATTA 0.968702 -104 ATCATTAATAATTTTATATGATAGTATTAAT 4 65 1 ATTTATATGA 0.973585 -84 AATACAAAAAAATTAATACTATCATATAAAA 4 76 0 AATTATACTA 0.954018 -73 **** ****** Masking position 4 Map Score: 11.0994 Number of sites scoring better than the average of aligned sites = 598 Number in coding regions = 334 Number in noncoding regions = 264 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 3 ATTGAAGATTAAGAGGAAGGTTTT 1 47 1 AAGAGGAAGG 0.992296 -14 ATTTAATTCGTAGAGGAAAAT 2 69 1 TAGAGGAAAA 0.987731 -11 AATAGTAAAAAAGAGGAAAA 4 1 0 AAGAGGAAAA 0.996239 -148 TGTTACTAATAATAGTAAAAAAGAGGAAAA 4 11 0 AATAGTAAAA 0.957495 -138 TAGGTATTTAAAGAGTAAAGGGGATT 4 133 1 AAGAGTAAAG 0.992182 -16 ********** Masking position 4 Map Score: 8.42401 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 68 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0