AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i248_cell_division_bbur_reg_300.orf -o248_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00684 79 3615 #2 RBB00663 114 3615 #3 RBB00659 46 3615 #4 RBB00657 36 3615 Motif number 1 AAATATTTTAAAAAAAGGTCAATT 1 2 0 AAAAAACAAT 0.990523 -78 TTCATATTATAATAAATAAAAATATTTTAAAAA 1 21 0 AATAAAAAAT 0.984738 -59 CCAATTACTGATAAATCTACAATTTCATATTAT 1 44 0 ATAAATCAAT 0.968751 -36 TTAAAATTAAAAACCAATTACTGATAAA 1 62 0 ATTAAACAAT 0.977539 -18 TAGTATACCAAATAATTATCAATTTAAAAAAAA 2 42 1 AATAATCAAT 0.988809 -73 TTATCAATTTAAAAAAAAAAAATTATTTGATAT 2 57 1 AAAAAAAAAT 0.98155 -58 TTTCAAGCTAAATTATATCAAATAATTTTTTTT 2 71 0 AATTATAAAT 0.889791 -44 TAAAAATGAAAGAAAAAATAAATACATTGCTCA 3 21 1 AGAAAAAAAT 0.942222 -26 ATTTAATAATCTGCAATAAAATAGGAG 4 5 1 AATAATCAAT 0.990457 -32 ****** **** Masking position 5 Map Score: 16.4807 Number of sites scoring better than the average of aligned sites = 491 Number in coding regions = 333 Number in noncoding regions = 158 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 2 ATTATAATAAATAAAAATATTTTAAAAAAA 1 19 0 ATAAAAATAT 0.920707 -61 TTATTATAATATGAAATTGTAGATTTATCA 1 39 1 ATGAAATTGT 0.955212 -41 TTAAAATTAAAAACCAATTA 1 70 0 TTAAAATTAA 0.92999 -10 ATTTTTTTTTTTTAAATTGATAATTATTTG 2 50 0 TTTAAATTGA 0.886468 -65 ATTTAAAAAAAAAAAATTATTTGATATAAT 2 63 1 AAAAAATTAT 0.919839 -52 ATAATTTAGCTTGAAATTAACTCCTAAAGG 2 88 1 TTGAAATTAA 0.954327 -27 TAGCGAGAAATAAAAATGAAAGAAAAAAT 3 10 1 ATAAAAATGA 0.949067 -37 AAAATGAAAGAAAAAATAAATACATTGCTC 3 23 1 AAAAAATAAA 0.772944 -24 ********** Masking position 5 Map Score: 6.71517 Number of sites scoring better than the average of aligned sites = 2041 Number in coding regions = 1315 Number in noncoding regions = 726 Number of orfs with sites within 600 bp upstream = 156 Fraction of orfs with sites within 600 bp upstream = 0.0250562 Motif number 3 ATAAATAAAAATATTTTAAAAAAAGGTCAAT 1 12 0 ATATTTTAAA 0.917653 -68 CTACAATTTCATATTATAATAAATAAAAATA 1 30 0 ATATTATAAA 0.981711 -50 AACCTTACTAATATTAGTATACCAAATAATT 2 28 1 ATATTAGTAA 0.940169 -87 ATTTCAAGCTAAATTATATCAAATAATTTTT 2 74 0 AAATTATATA 0.856581 -41 ATTAACTCCTAAAGGATAAAAC 2 103 1 AAAGGATAAA 0.92871 -12 ATTTTATTGCAGATTATTAAAT 4 2 0 AGATTATTAA 0.913191 -35 CTGCAATAAAATAGGAGAACAAACTT 4 21 1 ATAGGAGAAA 0.942383 -16 ********* * Masking position 3 Map Score: 3.15309 Number of sites scoring better than the average of aligned sites = 573 Number in coding regions = 337 Number in noncoding regions = 236 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 4 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0