AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i006_Pyrimidine_Biosynthesis_II_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pyrB 145 aspartate carbamoyltransferase Motif number 1 TAATGAAAGTCCAGAGAGGCTTGGAAGGGT 1 18 1 CCAGAGAGGC 0.995207 -128 GAAGGGTTATGAAGAGAAGGAAGCTTCAAT 1 41 1 GAAGAGAAGG 0.99577 -105 ATAGAGGGCAGCATTGAAGCTTCCTTCTCT 1 53 0 GCATTGAAGC 0.957733 -93 GGGTATGGTTAAATAGAGGGCAGCATTGAA 1 65 0 AAATAGAGGG 0.993473 -81 CTTAAGTTGAAAAGAGAGGGGAAAGAAC 1 128 1 AAAGAGAGGG 0.997094 -18 ********** Masking position 7 Map Score: 7.74659 Number of sites scoring better than the average of aligned sites = 272 Number in coding regions = 186 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 2 AGGCTTGGAAGGGTTATGAAGAGAAGGAAG 1 34 1 GGGTTATGAA 0.990922 -112 AGATAGACTCGGGGTATGGTTAAATAGAGG 1 76 0 GGGGTATGGT 0.994308 -70 AAAAAACCCCGGTCTAAGATAGACTCGGGG 1 92 0 GGTCTAAGAT 0.976035 -54 TGAAAAGAGAGGGGAAAGAAC 1 135 1 GGGGAAAGAA 0.991587 -11 ********** Masking position 6 Map Score: 3.18668 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 108 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 AGTCCAGAGAGGCTTGGAAGGGTTATGAAG 1 25 1 GGCTTGGAAG 0.979181 -121 GGCTTGGAAGGGTTATGAAGAGAAGGAAGC 1 35 1 GGTTATGAAG 0.981062 -111 CTCGGGGTATGGTTAAATAGAGGGCAGCAT 1 69 0 GGTTAAATAG 0.973589 -77 TTCAACTTAAGGCTGAAAAAAAACCCCGGT 1 109 0 GGCTGAAAAA 0.974887 -37 TTCAGCCTTAAGTTGAAAAGAGAGGGGAAA 1 122 1 AGTTGAAAAG 0.972919 -24 ********** Masking position 4 Map Score: 2.93214 Number of sites scoring better than the average of aligned sites = 782 Number in coding regions = 683 Number in noncoding regions = 99 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 4 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0