AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i012_Glycogen_Biosynthesis_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 glgD 23 ADP-glucose pyrophosphorylase #2 glgB 300 1,4-alpha-glucan branching enzyme Motif number 1 TATCATGATTTATAAAAACAAAAAAACCTTGCAGG 2 97 0 TAAAACAAAA 0.98427 -204 GTCTGTTTTTAAAATAAAGAACAAAATCTAAGACA 2 132 0 AAAAAGAAAA 0.986308 -169 CTTTATTTTAAAAACAGACTACAAAAATCTCCATA 2 148 1 AAAAACAAAA 0.996073 -153 TCATTTTCTGAAGAAAAACGAAATATATGGAGATT 2 173 0 AAAAACAATA 0.98427 -128 TATTTATTCGAAGAAATAAAAAAAAGCCCTTTCCT 2 238 0 AAAAAAAAAA 0.97984 -63 TATTTCTTCGAATAAATACTATAAATGAAAACTAT 2 255 1 AAAAACAAAA 0.996056 -46 ** * * ** * *** Masking position 8 Map Score: 8.97525 Number of sites scoring better than the average of aligned sites = 79 Number in coding regions = 51 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 GCGGTTAAGACACCGCCCTTTCACGGCGGTAA 2 21 1 CACGCCTTTC 0.993941 -280 ACGGGTCATCCAGAAGCCTTGCATATCCTGCA 2 71 1 CAAACCTTGC 0.990933 -230 TATAAAAACAAAAAAACCTTGCAGGATATGCA 2 90 0 AAAACCTTGC 0.992476 -211 GTCTATAAGTATAAGCGCTTTCAGGAAAGGGC 2 216 1 ATAGGCTTTC 0.925906 -85 AGAAATAAAAAAAAGCCCTTTCCTGAAAGCGC 2 230 0 AAAGCCTTTC 0.895041 -71 GTAATCATCCTTTCTGACATCATA 2 287 0 AACACCTTTC 0.99251 -14 ** ** ****** Masking position 9 Map Score: 8.08268 Number of sites scoring better than the average of aligned sites = 212 Number in coding regions = 163 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 3 TTACTGAAGAGGGGGCAGAG 1 1 1 TTACTGAAGA 0.968361 -23 CATATCATGATTTATAAAAACAAAAAAACC 2 104 0 TTTATAAAAA 0.699949 -197 AAAAACGAAATATATGGAGATTTTTGTAGT 2 165 0 TATATGGAGA 0.958995 -136 TTAACTTCATTTTCTGAAGAAAAACGAAAT 2 184 0 TTTCTGAAGA 0.967188 -117 GTATAAGCGCTTTCAGGAAAGGGCTTTTTT 2 224 1 TTTCAGGAAA 0.709905 -77 TTATAGTATTTATTCGAAGAAATAAAAAAA 2 249 0 TATTCGAAGA 0.819029 -52 ATAAATACTATAAATGAAAACTATGATGTC 2 266 1 TAAATGAAAA 0.881417 -35 ********** Masking position 8 Map Score: 2.55048 Number of sites scoring better than the average of aligned sites = 1862 Number in coding regions = 1618 Number in noncoding regions = 244 Number of orfs with sites within 600 bp upstream = 277 Fraction of orfs with sites within 600 bp upstream = 0.0444908 Motif number 4 ACTGAAGAGGGGGCAGAGTCA 1 13 1 GGGCAGAGTC 0.994424 -11 CGCCGTGAAAGGGCGGTGTCTTAACCGCTT 2 19 0 GGGCGGTGTC 0.998834 -282 CGCCCTTTCACGGCGGTAACACGGGTTCGA 2 34 1 CGGCGGTAAC 0.989789 -267 ********** Masking position 6 Map Score: 1.10012 Number of sites scoring better than the average of aligned sites = 103 Number in coding regions = 95 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 AAAAAACCTTGCAGGATATGCAAGGCTTCT 2 82 0 GCAGGATATG 0.992386 -219 TTTTTATAAATCATGATATGTCTTAGATTT 2 114 1 TCATGATATG 0.982433 -187 TCGTTTTTCTTCAGAAAATGAAGTTAATTG 2 187 1 TCAGAAAATG 0.982433 -114 ATAAGCGCTTTCAGGAAAGGGCTTTTTTTT 2 226 1 TCAGGAAAGG 0.992386 -75 ********** Masking position 6 Map Score: 3.90863 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 123 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 6 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0