AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i026_Fumarate_Reductase_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sdhA 33 succinate dehydrogenase (flavoprotein subunit) #2 sdhC 292 succinate dehydrogenase (cytochrome b558 subunit) Motif number 1 GATAGCCCCTCTCCCTCTAGTAATCTAG 1 16 0 CCCTCCCTCT 0.995773 -18 ATCTGTCTCCCCTCTCTCCTGCGTATA 2 7 1 CTCCCTCTCT 0.996621 -286 TTCTGTAATCCTCCCCCCTGTTTGAGCTATA 2 39 0 CTCCCCCTGT 0.998998 -254 TTTCATTTTACTCCTCCCTCAAAAGGGCGTC 2 180 0 CTCTCCCTCA 0.993748 -113 TGCTAAATCTCTTCCCCCACTTCTTTCAATT 2 240 0 CTCCCCCACT 0.997879 -53 TACTTTACCCCCTGTTTGATAAGTG 2 278 0 TTCCCCCTGT 0.993556 -15 ** ******** Masking position 6 Map Score: 14.4132 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 55 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 TTTCTTGCTTAATTTTTCATAAGAATTACAG 2 75 0 AATTTTCATA 0.917139 -218 GAAAAATTTTATTTTATCAATATATATTTCT 2 101 0 ATTTATCAAT 0.957217 -192 GATAAAATAAAATTTTTCAATCAACTAATCA 2 114 1 AATTTTCAAT 0.982742 -179 TTTTTCAATCAACTAATCAATTCGGAAAATT 2 126 1 AATAATCAAT 0.957535 -167 TCAATTCGGAAAATTATAATTTATGTACGCG 2 142 1 AATTATAATT 0.859393 -151 GAGTAAAATGAAATTGTCAATAAATCTTAAT 2 198 1 AATTGTCAAT 0.980088 -95 GCACATTTCGCACTTATCAAACAGGGGGTAA 2 268 1 CATTATCAAA 0.936008 -25 ** ******** Masking position 9 Map Score: 5.09479 Number of sites scoring better than the average of aligned sites = 469 Number in coding regions = 377 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 3 AAACAGGGGGGAGGATTACAGAATGATCCT 2 47 1 GAGGATTACA 0.923581 -246 AATTTTTCATAAGAATTACAGGATCATTCT 2 66 0 AAGAATTACA 0.966308 -227 TAATTCTTATGAAAAATTAAGCAAGAAATA 2 78 1 GAAAAATTAA 0.775575 -215 AAAATTAAGCAAGAAATATATATTGATAAA 2 90 1 AAGAAATATA 0.936734 -203 TAGTTGATTGAAAAATTTTATTTTATCAAT 2 111 0 AAAAATTTTA 0.893338 -182 AATCAATTCGGAAAATTATAATTTATGTAC 2 140 1 GAAAATTATA 0.945312 -153 AAGATTTATTGACAATTTCATTTTACTCCT 2 196 0 GACAATTTCA 0.9281 -97 GAAGTGGGGGAAGAGATTTAGCACATTTCG 2 248 1 AAGAGATTTA 0.797286 -45 ********** Masking position 2 Map Score: 3.77093 Number of sites scoring better than the average of aligned sites = 1002 Number in coding regions = 833 Number in noncoding regions = 169 Number of orfs with sites within 600 bp upstream = 171 Fraction of orfs with sites within 600 bp upstream = 0.0274655 Motif number 4 CCCCTCTCCCTCTAGTAATCTAGTACTC 1 9 0 TCTAGTAATC 0.981091 -25 TACAGGATCATTCTGTAATCCTCCCCCCTG 2 50 0 TTCTGTAATC 0.921471 -243 TACAGAATGATCCTGTAATTCTTATGAAAA 2 63 1 TCCTGTAATT 0.921471 -230 AATTTTTCAATCAACTAATCAATTCGGAAA 2 124 1 TCAACTAATC 0.973845 -169 CAAAAGGGCGTCAAGAAAACGCGTACATAA 2 162 0 TCAAGAAAAC 0.945458 -131 AATGAAATTGTCAATAAATCTTAATAAAGT 2 204 1 TCAATAAATC 0.930864 -89 ********** Masking position 7 Map Score: 2.4657 Number of sites scoring better than the average of aligned sites = 682 Number in coding regions = 624 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 5 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0