AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i042_Transketolase_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 tkt 168 transketolase Motif number 1 TATAAGAGGAATACGGCAATA 1 1 1 TATAAGAGAA 0.985665 -168 TTGATTATAGTATATGCAAAAGAGGAATACG 1 33 0 TATATGCAAA 0.976137 -136 TTGCATATACTATAATCAAAACTCTTATGTG 1 45 1 TATAATCAAA 0.837886 -124 TCAAAACTCTTATGTGACAAAATTCAACAAG 1 60 1 TATGTGAAAA 0.786146 -109 TCAGCTTAAATTTGAGAGAAACTTGTTGAAT 1 81 0 TTTGAGAAAA 0.971168 -88 TTCTCTCAAATTTAAGCTGAAACAGTTGAGA 1 92 1 TTTAAGCGAA 0.981724 -77 AGCTGAAACAGTTGAGAAAAAGTCGTCAGAC 1 106 1 GTTGAGAAAA 0.928983 -63 TCGTCAGACATTTATGATGTAAGGGTACAAC 1 128 1 TTTATGAGTA 0.905708 -41 TCCCCTTCCTTATGTGTTGTACCCTTACATC 1 143 0 TATGTGTGTA 0.83878 -26 ******* *** Masking position 3 Map Score: 12.0045 Number of sites scoring better than the average of aligned sites = 1258 Number in coding regions = 1024 Number in noncoding regions = 234 Number of orfs with sites within 600 bp upstream = 277 Fraction of orfs with sites within 600 bp upstream = 0.0444908 Motif number 2 TATAAGAGGAATACGGCAATATCGT 1 5 1 AGAGGAAACG 0.998472 -164 TATATGCAAAAGAGGAATACGATATTGCCGT 1 23 0 AGAGGAAACG 0.998472 -146 CTTAAATTTGAGAGAAACTTGTTGAATTTTG 1 77 0 AGAGAAATTG 0.990748 -92 GAAACAGTTGAGAAAAAGTCGTCAGACATTT 1 110 1 AGAAAAATCG 0.990734 -59 ******* *** Masking position 6 Map Score: 6.6448 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 81 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0