AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i042_Transketolase_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yneA 149 yneA #2 ynzC 63 ynzC #3 tkt 168 transketolase Motif number 1 GTACAAACATAGGTTCGAAAAAACAATTGACAGAAAC 1 66 1 ATCGAAAAAT 0.995537 -84 TAATTTCAGTATATACGAACAAACGTTTCTGTCAATT 1 90 0 ATCGAACAAT 0.992145 -60 GAAATTATAAAAATGCGAACAAACATTCCTGTTGGAG 1 120 1 ATCGAACAAT 0.992145 -30 ATATAGTACTAGATCAAAAAAAGTTTTACAACTGAT 2 10 0 ATAAAAAAAT 0.971495 -54 TATATAGACAAAATGCAATAAAGGAGTTTAAC 2 42 1 ATCAATAAAT 0.947647 -22 TGATTATAGTATATGCAAAAGAGGAATACGATATTGC 3 26 0 ATCAAAAGAT 0.958606 -143 TTCAGCTTAAATTTGAGAGAAACTTGTTGAATTTTGT 3 76 0 ATAGAGAAAT 0.964065 -93 AAGCTGAAACAGTTGAGAAAAAGTCGTCAGACATTTA 3 105 1 ATAGAAAAAT 0.988661 -64 * * ******* * Masking position 8 Map Score: 9.58459 Number of sites scoring better than the average of aligned sites = 262 Number in coding regions = 208 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 2 CGTCGATTTTAAGAAGATTATAGCATGATT 1 27 1 AAGAAGATTA 0.971948 -123 AACCTCCAACAGGAATGTTTGTTCGCA 1 133 0 AACAGGAATG 0.939563 -17 AAATGCAATAAAGGAGTTTAAC 2 52 1 AAGGAGTTTA 0.910255 -12 TATAAGAGGAATACGGCAATATC 3 4 1 AAGAGGAATA 0.989852 -165 GTATATGCAAAAGAGGAATACGATATTGCC 3 25 0 AAGAGGAATA 0.989852 -144 TTTGTCACATAAGAGTTTTGATTATAGTAT 3 51 0 AAGAGTTTTG 0.855932 -118 ACACATAAGGAAGGGGATTTTT 3 157 1 AAGGGGATTT 0.962932 -12 ********** Masking position 2 Map Score: 7.55873 Number of sites scoring better than the average of aligned sites = 569 Number in coding regions = 426 Number in noncoding regions = 143 Number of orfs with sites within 600 bp upstream = 139 Fraction of orfs with sites within 600 bp upstream = 0.0223257 Motif number 3 TTTAAGAAGATTATAGCATGATTTTCCTTA 1 34 1 TTATAGCATG 0.946528 -116 ATGATTTTCCTTACAGTACAAACATAGGTT 1 51 1 TTACAGTACA 0.970858 -99 ATTTTTATAATTTCAGTATATACGAACAAA 1 104 0 TTTCAGTATA 0.979929 -46 AGAGTTTTGATTATAGTATATGCAAAAGAG 3 40 0 TTATAGTATA 0.96854 -129 TTCTCAACTGTTTCAGCTTAAATTTGAGAG 3 94 0 TTTCAGCTTA 0.949852 -75 TGTTGTACCCTTACATCATAAATGTCTGAC 3 130 0 TTACATCATA 0.956809 -39 ********** Masking position 5 Map Score: 4.93836 Number of sites scoring better than the average of aligned sites = 516 Number in coding regions = 434 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 4 ACGATATTGCCGTATTCCTCTTATA 3 6 0 CGTATTCCTC 0.99799 -163 ACGGCAATATCGTATTCCTCTTTTGCATAT 3 23 1 CGTATTCCTC 0.99799 -146 ********** Masking position 5 Map Score: 1.94623 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 10 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ATCTTCTTAAAATCGACGTTTTGAGGTGCGAA 1 13 0 AAGACGTTTT 0.920987 -137 TGTTTTTTCGAACCTATGTTTGTACTGTAAGG 1 59 0 AATATGTTTG 0.955451 -91 AAACAATTGACAGAAACGTTTGTTCGTATATA 1 86 1 CAAACGTTTG 0.987415 -64 AACCTCCAACAGGAATGTTTGTTCGCATTTT 1 129 0 CAAATGTTTG 0.986769 -21 GTACTAGATCAAAAAAAGTTTTACAACTGAT 2 10 0 AAAAAGTTTT 0.902306 -54 ACCCTTACATCATAAATGTCTGACGACTTTTT 3 122 0 CAAATGTCTG 0.962433 -47 ** ******** Masking position 6 Map Score: 2.77864 Number of sites scoring better than the average of aligned sites = 239 Number in coding regions = 203 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 6 ATGTTTGTTCGCATTTTTATAATTTCAGTA 1 116 0 GCATTTTTAT 0.932813 -34 CTCCTTTATTGCATTTTGTCTATATAGTAC 2 38 0 GCATTTTGTC 0.988411 -26 TGTCACATAAGAGTTTTGATTATAGTATAT 3 49 0 GAGTTTTGAT 0.954376 -120 GAAACTTGTTGAATTTTGTCACATAAGAGT 3 65 0 GAATTTTGTC 0.98216 -104 ********** Masking position 5 Map Score: 0.84898 Number of sites scoring better than the average of aligned sites = 244 Number in coding regions = 219 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 7 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0