AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i045_Trehalose_Utilization_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 treP 192 phosphotransferase system (PTS) trehalose-specific enzyme IIBC component #2 treA 70 trehalose-6-phosphate hydrolase Motif number 1 GTCTGTTTCATATATTCCAGACTAGGATGA 1 74 1 TATATTCCAG 0.955708 -119 ATGAAAGCGCTATAAAAAAGTGTTGACTAC 1 100 1 TATAAAAAAG 0.979922 -93 TGACTACCTGTATATACAGGAATACAATAT 1 123 1 TATATACAGG 0.989291 -70 TTATAAGTTGTATATACAAGTTATAAAAAC 1 155 1 TATATACAAG 0.993688 -38 ATATACAAGTTATAAAAACGGATACGGAGG 1 166 1 TATAAAAACG 0.966251 -27 ********** Masking position 4 Map Score: 5.14661 Number of sites scoring better than the average of aligned sites = 136 Number in coding regions = 100 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 2 AGAGGCTCACCCTGCTTTTTAATGTCA 1 6 1 CTCACCCCTT 0.974031 -187 TTTTTTATAGCGCTTTCATCCTAGTCTGGAAT 1 87 0 CGCTTTCCCT 0.972635 -106 CCAACCCCTCCGTATCCGTTTTTATAACTTGT 1 170 0 CGTATCCTTT 0.984217 -23 CAACACGTCCCGCTCCCCACTTG 2 2 0 CGCTCCCCTT 0.997794 -69 ACGTGTTGAACGTTCCCTTTTCCCGTTTTCAA 2 26 1 CGTTCCCTTC 0.985272 -45 TCCCTTTTCCCGTTTTCAATTTAAATATGGTG 2 39 1 CGTTTTCTTT 0.975195 -32 ******* *** Masking position 7 Map Score: 3.65644 Number of sites scoring better than the average of aligned sites = 993 Number in coding regions = 893 Number in noncoding regions = 100 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 3 GCGCTATAAAAAAGTGTTGACTACCTGTAT 1 106 1 AAAGTGTTGA 0.973656 -87 AACGGATACGGAGGGGTTGGC 1 182 1 GAGGGGTTGG 0.992982 -11 TGGGGAGCGGGACGTGTTGAACGTTCCCTT 2 15 1 GACGTGTTGA 0.988336 -56 CAATTTAAATATGGTGGTGGAAACAG 2 55 1 ATGGTGGTGG 0.973119 -16 ********** Masking position 8 Map Score: 0.689565 Number of sites scoring better than the average of aligned sites = 122 Number in coding regions = 101 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 TTCCTGTATATACAGGTAGTCAACACTTTT 1 115 0 TACAGGTAGT 0.985586 -78 ACAATATGATTATAAGTTGTATATACAAGT 1 146 1 TATAAGTTGT 0.981342 -47 AAGTTGTATATACAAGTTATAAAAACGGAT 1 159 1 TACAAGTTAT 0.981345 -34 ********** Masking position 4 Map Score: 0.0871167 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 9 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0