AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i053_Altronate_Metabolism_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yjmC 104 similar to malate dehydrogenase #2 yjmE 24 similar to D-mannonate hydrolase #3 yjmG 47 similar to hexuronate transporter #4 yjmH 87 similar to transcriptional regulator (LacI family) #5 yjmI 76 similar to tagaturonate reductase Motif number 1 ACTCTCCAAGCGAAACCCCTACAAACACATTT 1 50 0 CAACCCCTAC 0.988972 -55 GCAAGTGCCTCCTTCCTTTTCA 1 93 0 GAATGCCTCC 0.972303 -12 GCTCGCACCTCCGGATTCAGTC 2 13 0 GTCCACCTCC 0.954954 -12 CTCAACCTCACCCCTATGTTGGTTCAG 3 31 0 CTCCCCCTAT 0.949084 -17 TATCATCAAACATACCGCCTCTCCCACTATAT 4 18 0 CTACGCCTCT 0.992245 -70 CCTTCCTTATCATACCGGCTGCGATTATTTAC 4 59 0 CTACGGCTGC 0.96336 -29 CTAATTCCCTTCCTTATCATAC 4 76 0 CAATCCCTTC 0.952122 -12 CCTTATTGCCTCCCTCTCACTTT 5 64 0 CTATGCCTCC 0.995448 -13 * ** ******* Masking position 10 Map Score: 6.46846 Number of sites scoring better than the average of aligned sites = 895 Number in coding regions = 764 Number in noncoding regions = 131 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 2 ATTTTAAATATTCTTTATATTATATTG 1 7 0 TTCTTATATT 0.92478 -98 ACATTTTATTTACAAATTATTTTAAATATTC 1 25 0 TACAATTATT 0.881042 -80 CCCCTACAAACACATTTTATTTACAAATTAT 1 36 0 CACATTTATT 0.975766 -69 CTCCTTCCTTTTCAGTTTTTTGGGCACTCTC 1 76 0 TTCATTTTTT 0.917931 -29 CCTATGTTGGTTCAGTTTCTGTTGCACCGCT 3 15 0 TTCATTTCTG 0.903728 -33 TACCGCCTCTCCCACTATATTTCCAGA 4 7 0 CCCATATATT 0.936824 -81 TGCGATTATTTACTGTATATTGTATCATCAA 4 41 0 TACTTATATT 0.904232 -47 TTGCCTCCCTCTCACTTTATGCACACGTTAA 5 51 0 CTCATTTATG 0.967631 -26 **** ****** Masking position 8 Map Score: 4.89457 Number of sites scoring better than the average of aligned sites = 952 Number in coding regions = 742 Number in noncoding regions = 210 Number of orfs with sites within 600 bp upstream = 239 Fraction of orfs with sites within 600 bp upstream = 0.0383874 Motif number 3 TGTGTTTGTAGGGGTTTCGCTTGGAGAGTG 1 53 1 GGGGTTTCGC 0.980936 -52 TCAGTTTTTTGGGCACTCTCCAAGCGAAAC 1 66 0 GGGCACTCTC 0.996689 -39 AAAAGGAAGGAGGCACTTGC 1 95 1 AGGCACTTGC 0.972739 -10 GTTTTTCAGCGGGCATTCTTTATACAGAAA 5 17 1 GGGCATTCTT 0.981892 -60 ********** Masking position 7 Map Score: 1.21671 Number of sites scoring better than the average of aligned sites = 240 Number in coding regions = 222 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 4 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0