AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_Glutamate_Synthase_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 gltA 146 glutamate synthase (large subunit) Motif number 1 GTTTGTCTCACATCCATCTATCTCATTTTG 1 8 1 TCACAATCTA 0.993593 -139 ATAATTTAGATCAAAAGAATCTCAAAATGAGAT 1 30 0 TCAAAATCTC 0.993593 -117 ATTCTTTTGATCTAAATTATATATTGTTTATAT 1 43 1 TCTAAATATA 0.989764 -104 TTGTAGGTTTTCAAAACGATATAAACAATATAT 1 61 0 TCAAAATATA 0.993371 -86 GGTCATAAAATCTAACAACTCTATAATCATTGT 1 90 0 TCTAACTCTA 0.990719 -57 ***** ***** Masking position 5 Map Score: 5.55769 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 95 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 TTTGATCTAAATTATATATTGTTTATATCG 1 48 1 ATTATATATT 0.761056 -99 TTATATATTGTTTATATCGTTTTGAAAACC 1 59 1 TTTATATCGT 0.953057 -88 CTCTATAATCATTGTAGGTTTTCAAAACGA 1 75 0 ATTGTAGGTT 0.96885 -72 ACCTACAATGATTATAGAGTTGTTAGATTT 1 86 1 ATTATAGAGT 0.955623 -61 ********** Masking position 5 Map Score: 1.24046 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 62 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0