AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i065_Histidine_Degradation_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 hutH 112 histidase Motif number 1 CTGTTTTCACGCATAGCCCCCTATCGTCTAAG 1 25 0 GCAAGCCCCT 0.99969 -88 GAAGTTCACAGCATAGCTCCTTTTTGTATGGG 1 56 1 GCAAGCCCTT 0.999508 -57 CTTTACTTTGGTAAAGCGCCCATACAAAAAGG 1 74 0 GTAAGCCCCA 0.996905 -39 AAGCCCAACTCCTTTTTCTTTACT 1 99 0 GCCAACCCTT 0.99677 -14 *** *** **** Masking position 5 Map Score: 7.71941 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 64 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CTATGCGTGAAAACAGAAGTTCACAGCATA 1 41 1 AAACAGAAGT 0.993914 -72 GCGCCCATACAAAAAGGAGCTATGCTGTGA 1 61 0 AAAAAGGAGC 0.997766 -52 CAAAGTAAAGAAAAAGGAGTTGGGCTT 1 96 1 AAAAAGGAGT 0.998112 -17 ********** Masking position 5 Map Score: 5.26919 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 102 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 3 TCGTCTAAGATCTATGGGCTGTT 1 4 0 TCTATGGGCT 0.997672 -109 CGCATAGCCCCCTATCGTCTAAGATCTATG 1 18 0 CCTATCGTCT 0.97128 -95 ACGATAGGGGGCTATGCGTGAAAACAGAAG 1 30 1 GCTATGCGTG 0.981242 -83 AGCTCCTTTTTGTATGGGCGCTTTACCAAA 1 70 1 TGTATGGGCG 0.995971 -43 ********** Masking position 5 Map Score: 2.05565 Number of sites scoring better than the average of aligned sites = 278 Number in coding regions = 235 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0