AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i067_2_1_1_13_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yitJ 300 similar to hypothetical proteins Motif number 1 TTTACCGAAAATAAAGACAATAATCAATA 1 7 0 ATAAGAAAAA 0.987682 -294 GTAAATTTGGAGAAAGGGAAAAACGCCAGATAT 1 35 1 AGAAGGAAAA 0.994943 -266 ATCCGTTCTTATCAAGAGAAGCAGAGGGACTGG 1 99 1 ATAAGAAACA 0.967017 -202 TCGAACAGCTTGGAAGATAAGAAGAGACAAAAT 1 199 1 TGAAGAAAAA 0.983205 -102 AGGAAAAAAGAGAAATAAAAAAAGTCCTCTTAA 1 251 0 AGAATAAAAA 0.973482 -50 TATTCACATCAGCAAGGAAAAAAGAGAAATAAA 1 265 0 AGAAGGAAAA 0.994943 -36 ** **** ** ** Masking position 5 Map Score: 7.88373 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 262 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 AAATTTACCGAAAATAAAGACAATAATCAAT 1 12 0 AAATAAAGAC 0.813251 -289 TTTGGAGAAAGGGAAAAACGCCAGATATCTT 1 40 1 GGAAAAACGC 0.871964 -261 TGCTTCTCTTGATAAGAACGGATATGAAATT 1 91 0 GAAAGAACGG 0.952591 -210 TTCTTATCAAGAGAAGCAGAGGGACTGGCCC 1 104 1 GAAAGCAGAG 0.982697 -197 CAGCTTGGAAGATAAGAAGAGACAAAATCAC 1 204 1 GAAAGAAGAG 0.991467 -97 AAGTCCTCTTAAGAAGAAGACTTTGTCAGTG 1 232 0 AAAAGAAGAC 0.979484 -69 AAAAAAGAGAAATAAAAAAAGTCCTCTTAAG 1 250 0 AAAAAAAAAG 0.796095 -51 ACATCAGCAAGGAAAAAAGAGAAATAAAAAA 1 262 0 GGAAAAAGAG 0.979911 -39 ATGTGAATAAAGGAGGCAGACA 1 289 1 AGAGGCAGAC 0.836406 -12 ** ******** Masking position 4 Map Score: 6.90574 Number of sites scoring better than the average of aligned sites = 2218 Number in coding regions = 1862 Number in noncoding regions = 356 Number of orfs with sites within 600 bp upstream = 370 Fraction of orfs with sites within 600 bp upstream = 0.0594282 Motif number 3 TTCGTGTCAGGAAGTGCCAAAAGATATCTGGC 1 59 0 GAAGGCCAAA 0.991984 -242 CTCTTGATAAGAACGGATATGAAATTTTCGTG 1 85 0 GAACGATAGA 0.976645 -216 GTGTAATGGCGATCAGCCATGACCAAGGTGCT 1 154 1 GATCGCCAGA 0.980197 -147 CAGCAAGCTCGAACAGCTTGGAAGATAAGAAG 1 191 1 GAACGCTTGA 0.956462 -110 TGGAAGATAAGAAGAGACAAAATCACTGACAA 1 209 1 GAAGGACAAA 0.990337 -92 AGCAAGGAAAAAAGAGAAATAAAAAAAGTCCT 1 256 0 AAAGGAAAAA 0.855068 -45 TTTCCTTGCTGATGTGAATAAAGGAGGCAGAC 1 278 1 GATGGAATAA 0.895919 -23 **** **** ** Masking position 2 Map Score: 4.15903 Number of sites scoring better than the average of aligned sites = 997 Number in coding regions = 918 Number in noncoding regions = 79 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 4 GGAAGTGCCAAAAGATATCTGGCGTTTTTC 1 52 0 AAAGATATCT 0.945573 -249 AATCACTGACAAAGTCTTCTTCTTAAGAGG 1 229 1 AAAGTCTTCT 0.989814 -72 AGAAATAAAAAAAGTCCTCTTAAGAAGAAG 1 244 0 AAAGTCCTCT 0.98383 -57 ********** Masking position 3 Map Score: 0.544848 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 45 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 AAAAACGCCAGATATCTTTTGGCACTTCCTGAC 1 53 1 GATTCTTGGC 0.911593 -248 TCAAGAGAAGCAGAGGGACTGGCCCGACGAAGC 1 110 1 CAGGGGTGGC 0.991059 -191 GCTTCAGCAACCGGTGTAATGGCGATCAGCCAT 1 141 1 CCGTGTTGGC 0.993864 -160 GGATTTAGCACCTTGGTCATGGCTGATCGCCAT 1 159 0 CCTGGTTGGC 0.996687 -142 AAGACTTTGTCAGTGATTTTGTCTCTTCTTATC 1 214 0 CAGGATTGTC 0.962878 -87 TCTCTTTTTTCCTTGCTGATGTGAATAAAGGAG 1 271 1 CCTGCTTGTG 0.941855 -30 *** *** **** Masking position 10 Map Score: 0.42638 Number of sites scoring better than the average of aligned sites = 755 Number in coding regions = 710 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0