AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i089_Sugar_Transport_1_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yurJ 181 similar to multiple sugar ABC transporter (ATP-binding protein) Motif number 1 TAACCTATTATTTATATTATAATGTATTATG 1 26 1 TTTTATTATA 0.993735 -156 AAAATGTAAATTTGTATTATAACGTCATAAT 1 51 0 TTTTATTATA 0.993941 -131 AAATTTACATTTTTTATTTTAGAAATATAGC 1 69 1 TTTTATTTTA 0.980379 -113 TCGATTCCCATTTTTGCTATATTTCTAAAAT 1 84 0 TTTTGCTATA 0.987633 -98 CAACTTGGTCTTTCTGTTATTTTTAGAGTAA 1 115 0 TTTTGTTATT 0.981798 -67 *** ******* Masking position 5 Map Score: 8.55287 Number of sites scoring better than the average of aligned sites = 88 Number in coding regions = 28 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 2 GGTAGCCTCCTTTTAACCTATTATTTATAT 1 13 1 TTTTAACCTA 0.95837 -169 ATTATTTATATTATAATGTATTATGACGTT 1 32 1 TTATAATGTA 0.972949 -150 TAAATTTGTATTATAACGTCATAATACATT 1 46 0 TTATAACGTC 0.985337 -136 AATTTACATTTTTTATTTTAGAAATATAGC 1 70 1 TTTTATTTTA 0.827855 -112 TTTCTGTTATTTTTAGAGTAATCGATTCCC 1 106 0 TTTTAGAGTA 0.922877 -76 TTTTGACCCGTTATTTCGTCACTGGAAACA 1 144 0 TTATTTCGTC 0.920445 -38 ********** Masking position 4 Map Score: 2.34526 Number of sites scoring better than the average of aligned sites = 523 Number in coding regions = 412 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 131 Fraction of orfs with sites within 600 bp upstream = 0.0210408 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0