AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i102_Ferric_Transport_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yclN 300 similar to ferrichrome ABC transporter (permease) #2 yclQ 21 similar to ferrichrome ABC transporter (binding protein) Motif number 1 ATTCCTCGTGAAAAATACAAATGTTCTCCTG 1 18 0 AAAAATAAAA 0.877978 -283 TTTCACGAGGAATAATGTTAGGTTTGCTGAC 1 36 1 AATAATGTAG 0.944655 -265 TTATAAAGATAAATATGGTAAACAGCCTAAC 1 79 1 AAATATGTAA 0.969191 -222 TTTTGGGATGGAAAATGGTTAGAATGATTAG 1 111 1 GAAAATGTTA 0.946847 -190 AATGATTAGTAAAATTGATAAATGACTAGGT 1 133 1 AAAATTGTAA 0.969191 -168 AATATTCTTTAAAAATATTAACCTAGTCATT 1 153 0 AAAAATATAA 0.975698 -148 CTAACCCTATAAAAATGGTAATATGTAAATG 1 186 1 AAAAATGTAA 0.994336 -115 ATATGTAAATGATAATGATAATCAATTACTA 1 206 1 GATAATGTAA 0.973255 -95 ******* *** Masking position 2 Map Score: 10.8836 Number of sites scoring better than the average of aligned sites = 820 Number in coding regions = 622 Number in noncoding regions = 198 Number of orfs with sites within 600 bp upstream = 209 Fraction of orfs with sites within 600 bp upstream = 0.0335689 Motif number 2 TAACGCAGGCATACGGTCAGCAAACCTAAC 1 52 0 ATACGGTCAG 0.969161 -249 ATAAAGATAAATATGGTAAACAGCCTAACG 1 81 1 ATATGGTAAA 0.947726 -220 TTGGGATGGAAAATGGTTAGAATGATTAGT 1 113 1 AAATGGTTAG 0.989541 -188 TAAAATTGATAAATGACTAGGTTAATATTT 1 142 1 AAATGACTAG 0.924551 -159 TACCATTTTTATAGGGTTAGTCAATATTCT 1 176 0 ATAGGGTTAG 0.966758 -125 AACCCTATAAAAATGGTAATATGTAAATGA 1 188 1 AAATGGTAAT 0.978637 -113 GGTAATATGTAAATGATAATGATAATCAAT 1 202 1 AAATGATAAT 0.912874 -99 ACTCAAAACAATATGGCCATATAGTAATTG 1 228 0 ATATGGCCAT 0.965503 -73 ********** Masking position 3 Map Score: 9.06679 Number of sites scoring better than the average of aligned sites = 547 Number in coding regions = 431 Number in noncoding regions = 116 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 3 TACGGTCAGCAAACCTAACATTATTCCTCG 1 41 0 AAACCTAACA 0.94784 -260 ATATGGTAAACAGCCTAACGTTTTGGGATG 1 91 1 CAGCCTAACG 0.988015 -210 AACCATTTTCCATCCCAAAACGTTAGGCTG 1 101 0 CATCCCAAAA 0.953882 -200 TTTTACTAATCATTCTAACCATTTTCCATC 1 117 0 CATTCTAACC 0.964192 -184 TGCCTCCTTACATCCTTACAGCAAAAAGAA 1 279 0 CATCCTTACA 0.986455 -22 ********** Masking position 8 Map Score: 1.26703 Number of sites scoring better than the average of aligned sites = 325 Number in coding regions = 256 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 4 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0