AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i120_Xanthine_Transport_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 xpt 300 xanthine phosphoribosyltransferase Motif number 1 AAAAATTCCCGAACTTTAATTTTGTTTTTTTA 1 48 0 GAACTTATTT 0.979035 -253 TAAAGTTCGGGAATTTTTATTTTCAGCCTATG 1 62 1 GAATTTATTT 0.982017 -239 CAAGAGATTAGAATCTTGATATAATTTATTAC 1 94 1 GAATTTATAT 0.982556 -207 AATATAATAGGAACACTCATATAATCGCGTGG 1 126 1 GAACCTATAT 0.986584 -175 AAAGAGCAAGCAATGCTGATATCACAAAAAAC 1 231 0 CAATCTATAT 0.978861 -70 TTTGAGCGGGCAATGCTTTTTTTATTCTCATA 1 264 1 CAATCTTTTT 0.919572 -37 **** ** **** Masking position 7 Map Score: 5.53989 Number of sites scoring better than the average of aligned sites = 171 Number in coding regions = 148 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 TTCAGCCTATGCAAGAGATTAGAATCTTGA 1 83 1 GCAAGAGATT 0.943585 -218 CGTGCCATATCCACGCGATTATATGAGTGT 1 138 0 CCACGCGATT 0.963671 -163 CGTGGATATGGCACGCAAGTTTCTACCGGG 1 153 1 GCACGCAAGT 0.980899 -148 CCGACTATGGGTGAGCAATGGAACCGCACG 1 195 1 GTGAGCAATG 0.96337 -106 CAAATAAAGAGCAAGCAATGCTGATATCAC 1 238 0 GCAAGCAATG 0.995146 -63 CTTTATTTGAGCGGGCAATGCTTTTTTTAT 1 259 1 GCGGGCAATG 0.990071 -42 ********** Masking position 8 Map Score: 5.32544 Number of sites scoring better than the average of aligned sites = 503 Number in coding regions = 478 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 AAATACGAATGATATCTAAAAAAACAAAATTAAA 1 32 1 GATATAAAAA 0.994464 -269 GTGTTCCTATTATATTGTAATAAATTATATCAAG 1 108 0 TATATAAAAA 0.704418 -193 TAATCGCGTGGATATGGCACGCAAGTTTCTACCG 1 147 1 GATATACCAA 0.973886 -154 AAGCAATGCTGATATCACAAAAAACCGTACACGT 1 222 0 GATATAAAAA 0.994464 -79 GTCTACCTCCGTTATGAGAATAAAAAAAGCATTG 1 274 0 GTTATAAAAA 0.949031 -27 ***** ** *** Masking position 9 Map Score: 3.66629 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 76 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 AGATATCATTCGTATTTCAAGGGGATTCGATATA 1 15 0 CGTATAGGGG 0.991745 -286 CACCCATAGTCGGACATTTACGGTGCCCGGTAGA 1 174 0 CGGATACGGT 0.998259 -127 GCAATGGAACCGCACGTGTACGGTTTTTTGTGAT 1 209 1 CGCATACGGT 0.996799 -92 ATTCTCATAACGGAGGTAGACAGG 1 287 1 CGGATACAGG 0.995527 -14 **** * ***** Masking position 7 Map Score: 0.38354 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 37 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 GGTAGAAACTTGCGTGCCATATCCACGCGA 1 150 0 TGCGTGCCAT 0.97002 -151 GCGGTTCCATTGCTCACCCATAGTCGGACA 1 192 0 TGCTCACCCA 0.961813 -109 ATATCAGCATTGCTTGCTCTTTATTTGAGC 1 241 1 TGCTTGCTCT 0.989555 -60 AAAAAAGCATTGCCCGCTCAAATAAAGAGC 1 256 0 TGCCCGCTCA 0.958898 -45 ********** Masking position 1 Map Score: 0.660352 Number of sites scoring better than the average of aligned sites = 263 Number in coding regions = 242 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0