AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i123_Daunorubicin_Resistance_Pump_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yfiL 143 similar to ABC transporter (ATP-binding protein) Motif number 1 TTTTGCATATACGCTTCTCTGAAAAGGCCT 1 20 1 ACGCTTCTCT 0.984966 -124 GGCCTGTAAAAGGCCTTTTCAGAGAAGCGT 1 30 0 AGGCCTTTTC 0.995422 -114 GGCCTTTTACAGGCCTTTTTTTCATGCCCT 1 45 1 AGGCCTTTTT 0.997932 -99 TACATGCCGCACGCCTTTCTTTCTTCTACA 1 91 1 ACGCCTTTCT 0.998683 -53 GTCGTCTCACTCCTTTTTTTGATCCATT 1 126 0 ACTCCTTTTT 0.992632 -18 ********** Masking position 6 Map Score: 11.3831 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 165 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 2 ATGAAAAAAAGGCCTGTAAAAGGCCTTTTC 1 40 0 GGCCTGTAAA 0.995903 -104 TAGAACATAGGGCATGAAAAAAAGGCCTGT 1 53 0 GGCATGAAAA 0.99394 -91 GGCATGTAGCGGCAGATAGAACATAGGGCA 1 69 0 GGCAGATAGA 0.989532 -75 AAAGGCGTGCGGCATGTAGCGGCAGATAGA 1 79 0 GGCATGTAGC 0.997234 -65 ********** Masking position 8 Map Score: 5.82557 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 88 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 AGAAGCGTATATGCAAAACGTCATATG 1 8 0 ATGCAAAACG 0.987125 -136 CCTTTTTTTCATGCCCTATGTTCTATCTGC 1 58 1 ATGCCCTATG 0.991276 -86 CTGCCGCTACATGCCGCACGCCTTTCTTTC 1 84 1 ATGCCGCACG 0.997827 -60 ********** Masking position 8 Map Score: 0.751151 Number of sites scoring better than the average of aligned sites = 63 Number in coding regions = 57 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0