AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i149_Thioredoxin_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 trxA 300 thioredoxin Motif number 1 GCAGGGCATGGTAAAGTACATGACAGTGAAGA 1 49 1 GTAAGTAATG 0.952807 -252 ACATGACAGTGAAGAGGAGATGTGATCTTATG 1 66 1 GAAAGGAATG 0.997123 -235 TTATATGGTTGAATGGGATATGCTCTTTTTTT 1 165 0 GAAGGGAATG 0.998721 -136 TAGCGTGAACGAATGGGAGATGCTATACTAAA 1 248 1 GAAGGGAATG 0.998721 -53 TGAATTCCTCCAATGTGAAATGATGATTTTTA 1 276 0 CAAGTGAATG 0.977009 -25 *** **** *** Masking position 8 Map Score: 7.60724 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 113 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 TAAAACCTGAAAAAGAGCGCCGGCATG 1 5 0 AAAGGCCCGG 0.989741 -296 TTCAGGTTTTAAAACAGCTCCGGCAGGGCATGG 1 27 1 AAACGCCCGG 0.989741 -274 AATAATCATTAAAATGGTACGAAGCATAAGATC 1 89 0 AAATGTCGAA 0.946727 -212 CCCGATCACTACAATTGCCCCAATAATCATTAA 1 110 0 AAATGCCCAA 0.99693 -191 CACAAATCTGATAATGGCCCCGATCACTACAAT 1 128 0 AAATGCCCGA 0.997454 -173 TGTAAGCATTAAAATAGCGTGAACGAATGGGAG 1 234 1 AAATGCTGAA 0.946727 -67 TATTGAATTCCTCCAATGTGAAATGA 1 285 0 TAATCCCCAA 0.928362 -16 * *** ** **** Masking position 4 Map Score: 6.53498 Number of sites scoring better than the average of aligned sites = 501 Number in coding regions = 469 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 AGTACATGACAGTGAAGAGGAGATGTGATC 1 63 1 AGTGAAGAGG 0.990985 -238 GGGCAATTGTAGTGATCGGGGCCATTATCA 1 123 1 AGTGATCGGG 0.995799 -178 TATAAAAATGAGTAAACCGGCTGTGATCAG 1 192 1 AGTAAACCGG 0.98423 -109 GTAAACCGGCTGTGATCAGGAAAAAATAAT 1 203 1 TGTGATCAGG 0.988967 -98 ********** Masking position 5 Map Score: 3.37598 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 122 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 TTTAAAACCTGAAAAAGAGCGCCGGCATG 1 10 0 GAAAAAGAGC 0.948401 -291 CAATTGCCCCAATAATCATTAAAATGGTAC 1 102 0 AATAATCATT 0.842941 -199 TTGTGTTTTAAAAAAAGAGCATATCCCATT 1 156 1 AAAAAAGAGC 0.980494 -145 TCAACCATATAAAAATGAGTAAACCGGCTG 1 185 1 AAAAATGAGT 0.983447 -116 GTGATCAGGAAAAAATAATTTGTAAGCATT 1 214 1 AAAAATAATT 0.903979 -87 ATGCTATACTAAAAATCATCATTTCACATT 1 267 1 AAAAATCATC 0.975682 -34 ********** Masking position 5 Map Score: 4.07857 Number of sites scoring better than the average of aligned sites = 1093 Number in coding regions = 884 Number in noncoding regions = 209 Number of orfs with sites within 600 bp upstream = 222 Fraction of orfs with sites within 600 bp upstream = 0.0356569 Motif number 5 CCTGAAAAAGAGCGCCGGCATG 1 3 0 AGCGCCGGCA 0.996911 -298 GTTTTAAAACAGCTCCGGCAGGGCATGGTA 1 32 1 AGCTCCGGCA 0.996515 -269 ********** Masking position 1 Map Score: 1.68854 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 20 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 TGAAAAAGAGCGCCGGCATG 1 1 0 CGCCGGCATG 0.99828 -300 TTTAAAACAGCTCCGGCAGGGCATGGTAAA 1 34 1 CTCCGGCAGG 0.996982 -267 ATCTCCTCTTCACTGTCATGTACTTTACCA 1 57 0 CACTGTCATG 0.981377 -244 ********** Masking position 8 Map Score: 1.41892 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 92 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0