AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i157_Alkyl_Hydroperoxide_reductase_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ahpC 300 alkyl hydroperoxide reductase (small subunit) Motif number 1 TATTCTGCTTTTGGCCATTGT 1 2 1 ATTCTGCTTT 0.990897 -299 GCTTTTGGCCATTGTCCTTTGCCCTTGACC 1 17 1 ATTGTCCTTT 0.965368 -284 ACGGCCTGGCATTCTGATTTACAAAAGTCC 1 76 1 ATTCTGATTT 0.989028 -225 TGAGAGGCTGATTCTCAATTAGATAAGGTT 1 111 0 ATTCTCAATT 0.964185 -190 TTATATATGAATTATTAATTAATATATATT 1 221 0 ATTATTAATT 0.91714 -80 TATAATTAGAATTATTATTGAAAGCGATTA 1 246 1 ATTATTATTG 0.886736 -55 ATTGAAAGCGATTATGCTTTCTAATACATT 1 262 1 ATTATGCTTT 0.985761 -39 ********** Masking position 1 Map Score: 8.38779 Number of sites scoring better than the average of aligned sites = 423 Number in coding regions = 355 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 2 ACATTTTATGACACCATGGTCAAGGGCAAAGGACAATGGCC 1 23 0 AATTAGCAAG 0.973499 -278 CCATGGTGTCATAAAATGTTCAAATGCCAAAACGGCCTGGC 1 45 1 AATTAACCAA 0.982011 -256 TAAGGTTTTCAGGGACTTTTGTAAATCAGAATGCCAGGCCG 1 77 0 AGTTAACAAA 0.982011 -224 AAAGTCCCTGAAAACCTTATCTAATTGAGAATCAGCCTCTC 1 99 1 AATTAAGAAA 0.986818 -202 CCTACCTGTCACACCTTTATTAAGATGAAAAAAAGTAGGTT 1 166 1 AATTAGGAAA 0.980535 -135 TAATTAATATATATTTTTTGTCAAGCCATAACCTACTTTTT 1 195 0 AATGAACAAA 0.981838 -106 ATTCCTCCTAAAAATGTATTAGAAAGCATAATCGCTTTCAA 1 263 0 AATTAACAAA 0.994395 -38 * * * * ** ** ** Masking position 13 Map Score: 4.04155 Number of sites scoring better than the average of aligned sites = 187 Number in coding regions = 156 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 ACCATGGTGTCATAAAATGTTCAAATGCCA 1 44 1 CATAAAATGT 0.982922 -257 TTATTAAGATGAAAAAAAGTAGGTTATGGC 1 182 1 GAAAAAAAGT 0.955496 -119 TATGGCTTGACAAAAAATATATATTAATTA 1 206 1 CAAAAAATAT 0.973405 -95 TATATTCCTCCTAAAAATGTATTAGAAAGC 1 277 0 CTAAAAATGT 0.982921 -24 ********** Masking position 5 Map Score: 2.10473 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 201 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 4 TATTCTGCTTTTGGCCATTGTCCTTT 1 7 1 GCTTTTGGCC 0.991843 -294 AATGCCAGGCCGTTTTGGCATTTGAACATT 1 59 0 CGTTTTGGCA 0.990048 -242 TGACAGGTAGGATTTAGGCATTTCTTTTAT 1 147 0 GATTTAGGCA 0.974815 -154 AAAAAAAGTAGGTTATGGCTTGACAAAAAA 1 193 1 GGTTATGGCT 0.983518 -108 ********** Masking position 4 Map Score: 1.49856 Number of sites scoring better than the average of aligned sites = 297 Number in coding regions = 280 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 5 CCCTGAAAACCTTATCTAATTGAGAATCAG 1 104 1 CTTATCTAAT 0.727753 -197 ATCAGCCTCTCATTTATTATAAAAGAAATG 1 129 1 CATTTATTAT 0.948928 -172 AGGATTTAGGCATTTCTTTTATAATAAATG 1 139 0 CATTTCTTTT 0.86931 -162 CTTGACAAAAAATATATATTAATTAATAAT 1 211 1 AATATATATT 0.496994 -90 AATATATATTAATTAATAATTCATATATAA 1 221 1 AATTAATAAT 0.770777 -80 ATTAATAATTCATATATAATTAGAATTATT 1 232 1 CATATATAAT 0.713207 -69 TCCTCCTAAAAATGTATTAGAAAGCATAAT 1 272 0 AATGTATTAG 0.769706 -29 AATGTATATTCCTCCTAAAA 1 291 0 AATGTATATT 0.713548 -10 ********** Masking position 7 Map Score: 2.52836 Number of sites scoring better than the average of aligned sites = 882 Number in coding regions = 635 Number in noncoding regions = 247 Number of orfs with sites within 600 bp upstream = 267 Fraction of orfs with sites within 600 bp upstream = 0.0428847 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0