AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i157_Alkyl_Hydroperoxide_reductase_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ahpC 300 alkyl hydroperoxide reductase (small subunit) Motif number 1 ACAATGGCCAAAAGCAGAATA 1 2 0 AAAGCAGAAT 0.989111 -299 GGTCAAGGGCAAAGGACAATGGCCAAAAGC 1 17 0 AAAGGACAAT 0.958783 -284 GGACTTTTGTAAATCAGAATGCCAGGCCGT 1 76 0 AAATCAGAAT 0.98688 -225 AACCTTATCTAATTGAGAATCAGCCTCTCA 1 111 1 AATTGAGAAT 0.957383 -190 AATATATATTAATTAATAATTCATATATAA 1 221 1 AATTAATAAT 0.902308 -80 TAATCGCTTTCAATAATAATTCTAATTATA 1 246 0 CAATAATAAT 0.867249 -55 AATGTATTAGAAAGCATAATCGCTTTCAAT 1 262 0 AAAGCATAAT 0.982984 -39 ********** Masking position 6 Map Score: 8.38779 Number of sites scoring better than the average of aligned sites = 423 Number in coding regions = 355 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 2 GCAAAGGACAATGGCCAAAAGCAGAATA 1 9 0 ATGGCCAAAA 0.989894 -292 AAAATGTTCAAATGCCAAAACGGCCTGGCA 1 57 1 AATGCCAAAA 0.993452 -244 TGGCATTCTGATTTACAAAAGTCCCTGAAA 1 82 1 ATTTACAAAA 0.948343 -219 TTATAAAAGAAATGCCTAAATCCTACCTGT 1 145 1 AATGCCTAAA 0.978781 -156 TAGGTTATGGCTTGACAAAAAATATATATT 1 201 1 CTTGACAAAA 0.977491 -100 ********** Masking position 8 Map Score: 5.25473 Number of sites scoring better than the average of aligned sites = 480 Number in coding regions = 423 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 3 CCCTGAAAACCTTATCTAATTGAGAATCAG 1 104 1 CTTATCTAAT 0.748888 -197 ATCAGCCTCTCATTTATTATAAAAGAAATG 1 129 1 CATTTATTAT 0.934992 -172 AGGATTTAGGCATTTCTTTTATAATAAATG 1 139 0 CATTTCTTTT 0.890866 -162 CTTGACAAAAAATATATATTAATTAATAAT 1 211 1 AATATATATT 0.498749 -90 AATATATATTAATTAATAATTCATATATAA 1 221 1 AATTAATAAT 0.747129 -80 ATTAATAATTCATATATAATTAGAATTATT 1 232 1 CATATATAAT 0.870195 -69 TATGCTTTCTAATACATTTTTAGGAGGAAT 1 274 1 AATACATTTT 0.759312 -27 AATGTATATTCCTCCTAAAA 1 291 0 AATGTATATT 0.641587 -10 ********** Masking position 7 Map Score: 2.94492 Number of sites scoring better than the average of aligned sites = 817 Number in coding regions = 580 Number in noncoding regions = 237 Number of orfs with sites within 600 bp upstream = 250 Fraction of orfs with sites within 600 bp upstream = 0.0401542 Motif number 4 TTGAACATTTTATGACACCATGGTCAAGGGC 1 37 0 TATGACACCT 0.957411 -264 TAAATCAGAATGCCAGGCCGTTTTGGCATTT 1 66 0 TGCCAGGCCT 0.9916 -235 AAATCCTACCTGTCACACCTTTATTAAGATG 1 162 1 TGTCACACCT 0.995841 -139 ATATATTTTTTGTCAAGCCATAACCTACTTT 1 197 0 TGTCAAGCCT 0.992689 -104 ********* * Masking position 5 Map Score: 0.697587 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 127 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0