AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i166_Nitrate_Transport_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ygaL 300 similar to nitrate ABC transporter (binding protein) #2 ytlA 150 ytlA Motif number 1 AAAGCTGTTACAACAAGGTTTTTCAACAAT 1 74 0 CAACAAGGTT 0.93525 -227 TTAAGTGTCATAAAAAGCTGTTACAACAAG 1 87 0 TAAAAAGCTG 0.939833 -214 TCTATTTGCGAAACAAGCAGAGTAAGTGAT 1 145 1 AAACAAGCAG 0.973171 -156 AGTAAGTGATAAACAAGGATATCAAAAATC 1 165 1 AAACAAGGAT 0.983019 -136 AAATCGTATTTAAAAAAGAGTTGACATATC 1 190 1 TAAAAAAGAG 0.893439 -111 AAGCATATAGAAAAAAGGAGGCGGCTGTT 2 10 0 AAAAAAGGAG 0.990599 -141 TGTGAATGCCTAACCAGGTTCTCCGGATGT 2 56 0 TAACCAGGTT 0.870017 -95 ATGATGGGTATAAAAATGTGTGAATGCCTA 2 74 0 TAAAAATGTG 0.851342 -77 TATGTAAAGCAAAAAAGGATATTAACTTGA 2 108 1 AAAAAAGGAT 0.978245 -43 ACTTGATGCGAAATAAGGAGGTTGTCTAT 2 132 1 AAATAAGGAG 0.962955 -19 ********** Masking position 6 Map Score: 12.8588 Number of sites scoring better than the average of aligned sites = 1371 Number in coding regions = 995 Number in noncoding regions = 376 Number of orfs with sites within 600 bp upstream = 424 Fraction of orfs with sites within 600 bp upstream = 0.0681015 Motif number 2 GTCAATATTATTTTATAATTATT 1 4 1 AATATTATTT 0.963857 -297 ATATTATTTTATAATTATTATAAAATAGTT 1 15 1 ATAATTATTA 0.934652 -286 ATTAATAGAGATAACTATTTTATAATAATT 1 27 0 ATAACTATTT 0.956607 -274 TATTTCTCCAAAAATTATTAAGTGTCATAA 1 104 0 AAAATTATTA 0.963857 -197 TAGAGAAGGAAAAATTATTTCTCCAAAAAT 1 119 0 AAAATTATTT 0.979818 -182 CTCTTTTTTAAATACGATTTTTGATATCCT 1 180 0 AATACGATTT 0.888397 -121 ********** Masking position 4 Map Score: 5.08718 Number of sites scoring better than the average of aligned sites = 214 Number in coding regions = 143 Number in noncoding regions = 71 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 3 GTTACAACAAGGTTTTTCAACAATTTCGATACT 1 65 0 GGTTTTCAAA 0.978097 -236 AAGGAAAAATTATTTCTCCAAAAATTATTAAGT 1 111 0 TATTTTCCAA 0.827154 -190 TTACTCTGCTTGTTTCGCAAATAGAGAAGGAAA 1 137 0 TGTTTGCAAA 0.963907 -164 TTGATATCCTTGTTTATCACTTACTCTGCTTGT 1 157 0 TGTTTTCACA 0.966444 -144 TGAATTAACATGTTATTCAAACAAAAAAACAAT 1 229 1 TGTTATCAAA 0.974658 -72 CGGAGAACCTGGTTAGGCATTCACACATTTTTA 2 61 1 GGTTAGCATA 0.950469 -90 TCATACGATATGTAAAGCAAAAAAGGATATTAA 2 100 1 TGTAAGCAAA 0.933159 -51 ACAACCTCCTTATTTCGCATCAAGTTAATATCC 2 124 0 TATTTGCATA 0.925621 -27 ***** **** * Masking position 13 Map Score: 4.80774 Number of sites scoring better than the average of aligned sites = 435 Number in coding regions = 359 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 4 GTTATCTCTATTAATCGATATATAGTATCGAA 1 42 1 TAACGATATA 0.911222 -259 TAATTCAAATTATTCCGATATGTCAACTCTTT 1 204 0 TTTCGATATG 0.976397 -97 GCCGCCTCCTTTTTTCTATATGCTTTCCTTAC 2 15 1 TTTCTATATG 0.952629 -136 TTTATACCCATCATACGATATGTAAAGCAAAA 2 90 1 TATCGATATG 0.993419 -61 GATATTAACTTGATGCGAAATAAGGAGGTTGT 2 125 1 TATCGAAATA 0.950832 -26 * ** ******* Masking position 8 Map Score: 2.10268 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 77 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 5 GGAAAAATTATTTCTCCAAAAATTATTAAG 1 112 0 TTTCTCCAAA 0.98157 -189 GAATAACATGTTAATTCAAATTATTCCGAT 1 217 0 TTAATTCAAA 0.96007 -84 GAATTAACATGTTATTCAAACAAAAAAACA 1 230 1 GTTATTCAAA 0.933854 -71 TATGCTTTCCTTACTCCAAAATTACATCCG 2 33 1 TTACTCCAAA 0.982857 -118 ********** Masking position 5 Map Score: 1.5616 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 199 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0