AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i170_Urease_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ureA 300 urease (gamma subunit) Motif number 1 CAGATTTTAATTGTCGAACTAGTCAGACAAGTTATTA 1 14 1 TTCGATCAGA 0.997834 -287 AGACAAGTTATTATAGAAATTTCCAGAAAAAAAGACA 1 38 1 TTAGATCAGA 0.986193 -263 AAAGATCAGATTAACGCGTTTTCCAGACTGCGCTCGA 1 88 0 TTCGGTCAGA 0.997393 -213 TAATCTGATCTTTCCGTGATCGACAGGGGAACGGTTG 1 112 1 TTCGGTCAGG 0.996859 -189 CTACTACGAATTTGCGGAACAGTCAGGCGGGACATCA 1 235 0 TTCGACCAGG 0.994077 -66 CCTCCTTCTTTTGTCATATAAAGCAGATGCGGCTACT 1 267 0 TTCAAACAGA 0.955981 -34 ** ** * * **** Masking position 15 Map Score: 6.94998 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 100 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 CTTGCCATGGTCAACAACCGTTCCCCTGTCGAT 1 130 0 TCACCCGTTC 0.997705 -171 TGCCGTTTCTTCATCAGCCTTGCCATGGTCAAC 1 148 0 TCACCCTTGC 0.997732 -153 GGTCATACGGTAAGATGCCTTTCAAAGCGGCAT 1 180 0 TAAACCTTTC 0.97953 -121 AGGCGGGACATCACCTCCCTTTCTTCGAGAATG 1 215 0 TCACCCTTTC 0.998652 -86 *** * ****** Masking position 3 Map Score: 3.25652 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 38 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 GAAATTTCCAGAAAAAAAGACATTTGTTAT 1 53 1 GAAAAAAAGA 0.963059 -248 CAAGGCTGATGAAGAAACGGCATGCCGCTT 1 159 1 GAAGAAACGG 0.992629 -142 CCCCATTCTCGAAGAAAGGGAGGTGATGTC 1 212 1 GAAGAAAGGG 0.992629 -89 CTTTATATGACAAAAGAAGGAGGACTACAG 1 281 1 CAAAAGAAGG 0.957743 -20 ********** Masking position 5 Map Score: 1.20485 Number of sites scoring better than the average of aligned sites = 462 Number in coding regions = 382 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 4 ATGGTCAACAACCGTTCCCCTGTCGATCAC 1 127 0 ACCGTTCCCC 0.989911 -174 CATCTTACCGTATGACCCCCATTCTCGAAG 1 196 1 TATGACCCCC 0.974351 -105 AAAGGGAGGTGATGTCCCGCCTGACTGTTC 1 226 1 GATGTCCCGC 0.992371 -75 GTCCCGCCTGACTGTTCCGCAAATTCGTAG 1 239 1 ACTGTTCCGC 0.992687 -62 ********** Masking position 4 Map Score: 1.07025 Number of sites scoring better than the average of aligned sites = 204 Number in coding regions = 183 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0