AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i170_Urease_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ureA 300 urease (gamma subunit) Motif number 1 CAGATTTTAATTGTCGAACTAGTCAGACAAGTTATTA 1 14 1 TTCGATCAGA 0.998042 -287 AGACAAGTTATTATAGAAATTTCCAGAAAAAAAGACA 1 38 1 TTAGATCAGA 0.987515 -263 AAAGATCAGATTAACGCGTTTTCCAGACTGCGCTCGA 1 88 0 TTCGGTCAGA 0.997645 -213 TAATCTGATCTTTCCGTGATCGACAGGGGAACGGTTG 1 112 1 TTCGGTCAGG 0.997163 -189 CTACTACGAATTTGCGGAACAGTCAGGCGGGACATCA 1 235 0 TTCGACCAGG 0.994616 -66 CCTCCTTCTTTTGTCATATAAAGCAGATGCGGCTACT 1 267 0 TTCAAACAGA 0.960082 -34 ** ** * * **** Masking position 15 Map Score: 6.94998 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 100 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 ATCGACAGGGGAACGGTTGTTGACCATGGCAAG 1 130 1 GAACGGGTGA 0.997882 -171 GTTGACCATGGCAAGGCTGATGAAGAAACGGCA 1 148 1 GCAAGGGTGA 0.997912 -153 ATGCCGCTTTGAAAGGCATCTTACCGTATGACC 1 180 1 GAAAGGTTTA 0.981149 -121 CATTCTCGAAGAAAGGGAGGTGATGTCCCGCCT 1 215 1 GAAAGGGTGA 0.998756 -86 ****** * *** Masking position 3 Map Score: 3.25652 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 38 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 GATTTTAATTGTCGAACTAGTCAGACAAGTT 1 16 1 GTCGACTAGT 0.947425 -285 TGTTATCTTAGTCGAGCGCAGTCTGGAAAAC 1 77 1 GTCGACGCAG 0.986459 -224 CCGTTCCCCTGTCGATCACGGAAAGATCAGA 1 115 0 GTCGACACGG 0.998459 -186 GGGAACGGTTGTTGACCATGGCAAGGCTGAT 1 138 1 GTTGACATGG 0.987698 -163 CCTCCCTTTCTTCGAGAATGGGGGTCATACG 1 204 0 TTCGAAATGG 0.93897 -97 ***** ***** Masking position 5 Map Score: 1.68647 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 213 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 CCTGTCGATCACGGAAAGATCAGATTAACG 1 109 0 ACGGAAAGAT 0.995513 -192 TGGGGGTCATACGGTAAGATGCCTTTCAAA 1 187 0 ACGGTAAGAT 0.995317 -114 ********** Masking position 6 Map Score: 0.50812 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 15 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 CGTGATCGACAGGGGAACGGTTGTTGACCA 1 126 1 AGGGGAACGG 0.981057 -175 TCTTCGAGAATGGGGGTCATACGGTAAGAT 1 197 0 TGGGGGTCAT 0.98403 -104 GGAACAGTCAGGCGGGACATCACCTCCCTT 1 227 0 GGCGGGACAT 0.992417 -74 ACTACGAATTTGCGGAACAGTCAGGCGGGA 1 240 0 TGCGGAACAG 0.993618 -61 ********** Masking position 5 Map Score: 1.07025 Number of sites scoring better than the average of aligned sites = 228 Number in coding regions = 209 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0