AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i182_riboflafin_biosynthesis_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ribH 32 riboflavin synthase (beta subunit) #2 ypuE 258 ypuE Motif number 1 CCCTTCGATCCGAAAGGTGATGTTTT 2 6 0 CGAAGGTGAT 0.982455 -253 CCTTTCGGATCGAAGGGTGATGTTTTGTTTT 2 20 1 CGAGGGTGAT 0.995525 -239 GTATCTTCGGGGCAGGGTGGAAATCCCGACC 2 131 1 GGCGGGTGGA 0.993445 -128 GTGGAAATCCCGACCGGCGGTAGTAAAGCAC 2 147 1 CGACGGCGGT 0.990842 -112 TGTGCATAAGCACGCGGTGGATTCAGTTTAA 2 202 1 CACCGGTGGA 0.968531 -57 GTGAAAGTCTGGATGGGAGAAGG 2 246 1 GGAGGGAGAA 0.972485 -13 *** ******* Masking position 6 Map Score: 5.29542 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 226 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 TCACAAATATCACAAAAAAGGAT 1 4 1 CAAATATCAC 0.988462 -29 AAAACATCACCTTTCGGATC 2 1 1 AAAACATCAC 0.996425 -258 TGAGAAAAACAAAACATCACCCTTCGATCC 2 26 0 AAAACATCAC 0.996425 -233 ********** Masking position 6 Map Score: 4.20329 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 37 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 AAATATCACAAAAAAGGATGGGAATCAT 1 15 1 AAAAAGGATG 0.995497 -18 TGCGTACTTTAAAAAGGATCGCTATAATAAC 2 75 1 AAAAAGGATG 0.995497 -184 TATAATAACCAATAAGGACAAATGAATAAAG 2 97 1 AATAAGGACA 0.970276 -162 AGGACAAATGAATAAAGATTGTATCTTCGGG 2 111 1 AATAAAGATG 0.982347 -148 ********* * Masking position 5 Map Score: 3.29969 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 81 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 TATTTCATTGCGTACTTTAAAAAGGATCGC 2 67 1 CGTACTTTAA 0.972702 -192 TACCGCCGGTCGGGATTTCCACCCTGCCCC 2 139 0 CGGGATTTCC 0.975737 -120 CTAAAGCAAATGTGCTTTACTACCGCCGGT 2 159 0 TGTGCTTTAC 0.94321 -100 ACACGGGTCACGGGCTCTAAAGCAAATGTG 2 175 0 CGGGCTCTAA 0.987876 -84 TTCTCCCATCCAGACTTTCACTGTCGGCTT 2 237 0 CAGACTTTCA 0.943208 -22 ********** Masking position 6 Map Score: 0.922508 Number of sites scoring better than the average of aligned sites = 960 Number in coding regions = 864 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 5 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0