AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i201_excinuclease_abc_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 uvrB 185 excinuclease ABC (subunit B) Motif number 1 AGCAGGTATTCAGTCTTTATATTCATTATGTC 1 15 0 CAGCTTTTAT 0.985264 -171 GACTGAATACCTGCTTTTACGTTTTAAAAGCA 1 32 1 CTGTTTTCGT 0.989471 -154 GTTTTAAAAGCAGGTTTTTTATACACAAAAAC 1 52 1 CAGTTTTTAT 0.990036 -134 TTATTTCCAGCTGTTTTTGTGTATAAAAAACC 1 64 0 CTGTTTTTGT 0.992891 -122 CTAAAGTTCGGTGGTTTTTTATTTCCAGCTGT 1 82 0 GTGTTTTTAT 0.98995 -104 CGTATTTTTAGTGATTTTGCTTTCCATTGTGT 1 116 1 GTGTTTTCTT 0.978836 -70 TAAAGAAACGGAGGCTTATTTTT 1 173 1 GAGCTTATTT 0.880598 -13 *** **** *** Masking position 6 Map Score: 9.37514 Number of sites scoring better than the average of aligned sites = 1017 Number in coding regions = 829 Number in noncoding regions = 188 Number of orfs with sites within 600 bp upstream = 160 Fraction of orfs with sites within 600 bp upstream = 0.0256987 Motif number 2 ATAATGAATATAAAGACTGAATACCTGCTT 1 18 1 TAAAGACTGA 0.887552 -168 TTTTAAAACGTAAAAGCAGGTATTCAGTCT 1 31 0 TAAAAGCAGG 0.978683 -155 TTTTACGTTTTAAAAGCAGGTTTTTTATAC 1 46 1 TAAAAGCAGG 0.978683 -140 CAGCTGGAAATAAAAAACCACCGAACTTTA 1 83 1 TAAAAAACCA 0.879891 -103 AAATACGAACTAAAGTTCGGTGGTTTTTTA 1 93 0 TAAAGTTCGG 0.909598 -93 GCAAAATCACTAAAAATACGAACTAAAGTT 1 106 0 TAAAAATACG 0.931612 -80 TTCCTATAGATATAGTAACACAATGGAAAG 1 135 0 TATAGTAACA 0.811487 -51 TTACTATATCTATAGGAAGATTTCGTTAAA 1 147 1 TATAGGAAGA 0.923161 -39 AAGATTTCGTTAAAGAAACGGAGGCTTATT 1 163 1 TAAAGAAACG 0.980368 -23 ********** Masking position 4 Map Score: 8.99947 Number of sites scoring better than the average of aligned sites = 1710 Number in coding regions = 1392 Number in noncoding regions = 318 Number of orfs with sites within 600 bp upstream = 316 Fraction of orfs with sites within 600 bp upstream = 0.0507549 Motif number 3 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0